Genser ясенево: сеть автотехцентров по ремонту автомобилей

Содержание

Официальный дилер Ниссан в Москве

Официальный дилер Nissan GN SERVICE

Автосалон GN service Ясенево является официальным дилером Nissan в Москве. Цель компании состоит в донесении качества и надежности автомобилей Nissan, предоставление услуг автосервиса.

Мы всегда приветливо встретим вас в нашем салоне и поможем:

  • Выбрать и купить авто;
  • Ознакомить вас с акциями и специальными предложениями;
  • Определиться с цветом, основной и дополнительной комплектацией;
  • Провести тест-драйв;
  • Оформить кредит на машину;
  • Предоставить обслуживание и ремонт;
  • Подобрать и заказать запчасти (оригинальные или аналоги хорошего качества) и аксессуары.

Прерогативой компании является приветливость и забота о клиентах. Мы понимаем, насколько важно решение о покупке авто в вашей жизни.

Поэтому стараемся найти индивидуальный подход к каждому посетителю и предоставить выгодные условия.


Один из крупнейших автопарков новых машин Ниссан


Индивидуальные специальные предложения на покупку


Удачное расположение автосалона в черте города на Юго-Западе


Наличие обзоров, фото и характеристик автомобилей прямо на сайте

Продажа автомобилей Ниссан в Москве

Как официальный дилер Nissan, мы рады представить вашему вниманию модельный ряд японского автоконцерна. За последнее десятилетие авторынок сильно изменился. Добавились новые форм-факторы. Теперь кроссоверы занимают нишу рынка даже большую, чем хэтчбеки. Популярность компактных внедорожников вызвыла реакцию компаний. Кто-то не сразу смог удовлетворить запрос покупателя, но Ниссан вовремя обновил свой модельный ряд. Который оказался, как никогда, актуальным. А такие модели, как новый Qashqai и X-trail долгое время занимали ведущие строчки продаж автомобилей в России.

Купить автомобиль Ниссан в GN Service

В нашем автосалоне вы сможете приобрести любой понравившийся автомобиль из линейки Ниссан. К вашим услугам отдел по продажам автомобилей, специалисты которого помогут вам определиться с выбором, дадут исчерпывающие ответы на любые ваши вопросы и консультируют по акциям автосалона. В перечень услуг Nissan GN Service входят такие, как:

  • Продажа авто по системе Trade-In;
  • Продажа в лизинг для юридических лиц и ИП;
  • Оформление документации и постановка на учёт;
  • Оформление договоров страхования;
  • Гарантийное и плановое обслуживание.

официальный дилер Saab, id 3606

Тип закрытого кузова легкового автомобиля с багажником, структурно отделённым от пассажирского салона и без подъёмной двери в задней стенке.

Тип закрытого кузова легкового автомобиля с дверью в задней стенке и укороченным задним свесом.

Тип закрытого кузова легкового автомобиля с дверью в задней стенке, багажником, объединённым с салоном, и крышей багажника продлённой до заднего габарита.

Тип закрытого кузова легкового автомобиля, являющийся промежуточным между седаном, универсалом и хетчбеком. От хетчбэка он отличается большей длиной заднего свеса: у лифтбэка он по длине такой же, как у седана. Задняя часть крыши при этом может быть как покатой, так и (реже) ступенчатой, напоминающей седан.

Тип закрытого кузова легкового автомобиля с двумя дверьми, одним или двумя рядами сидений и структурно отделённым багажником, без двери в задней стенке. Объём заднего пассажирского отделения обычно не превышает 0,93 м³.

Тип кузова легкового автомобиля с откидывающимся мягким или жёстким верхом и двумя дверьми. Число мест более двух.

Тип кузова двухместного спортивного легкового автомобиля без крыши или с жёсткой крышей.

Тип кузова легкового автомобиля, являющийся разновидностью спортивного 2-местного родстера с жёстко закреплённым ветровым стеклом, дугой безопасности (roll bar) сзади сидений, съёмной крышей и задним стеклом.

Тип закрытого кузова легкового автомобиля, с жёсткой, обычно оснащённой подъёмным стеклом, перегородкой между отделением водителя и остальным салоном. Кузов удлинён в разной степени по сравнению с обычным седаном.

Тип закрытого кузова легкового автомобиля, выполненного посредством физической врезки в кузов дополнительной секции, расположенной между передними и задними дверьми, что способствует удлинению салона.

Тип закрытого кузова автомобиля, обладающий повышенной проходимостью и увеличенным просветом.

Тип закрытого кузова автомобиля, сочетающий в себе свойства внедорожника и универсала или хетчбека.

Тип кузова коммерческого двухместного автомобиля с открытой грузовой платформой.

Тип закрытого кузова коммерческого двухместного автомобиля с закрытой грузовой платформой (багажное отделение с дверью на задней стенке).

Тип закрытого кузова легкового автомобиля, совмещённый с багажным отделением, обычно — с тремя рядами сидений. Увеличенный внутренний объём салона. Максимальная вместимость салона – 8 пассажиров.

Тип закрытого кузова коммерческого автомобиля, являющегося автобусом малого класса с числом мест от 8 до 16 и непредусмотренными стоячими местами.

Supplier profile Общество с ограниченной ответственностью «Дженсер Ясенево»

Contract number: 2402904010918000005
Customer: ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ КАЛУЖСКОЙ ОБЛАСТИ «АВТОХОЗЯЙСТВО АДМИНИСТРАЦИИ ГУБЕРНАТОРА КАЛУЖСКОЙ ОБЛАСТИ»

Subject: Оказание услуг по диагностике, техническому обслуживанию и ремонту автотранспортных средств марки Форд

Conclusion date: 2018-01-16
Execution completion date:
2018-12-31

2 000 000

Contract number: 87706042076170000380000
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ ИНСТИТУТ ГЕОЛОГИИ РУДНЫХ МЕСТОРОЖДЕНИЙ, ПЕТРОГРАФИИ, МИНЕРАЛОГИИ И ГЕОХИМИИ РОССИЙСКОЙ АКАДЕМИИ НАУК

Subject: Услуги по техническому осмотру автотранспортных средств

Conclusion date: 2017-12-11
Execution completion date: 2017-12-15

12 100

Contract number: 1770236131417000804
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ «ВОЙСКОВАЯ ЧАСТЬ 55056»

Subject: Полноприводные автомобили Nissan X-Trail

Conclusion date: 2017-11-24
Execution completion date: 2017-12-31

5 832 000

Contract number:
1770236131417000773
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ «ВОЙСКОВАЯ ЧАСТЬ 55056»

Subject: NISSAN X-Trail

Conclusion date: 2017-11-20
Execution completion date: 2017-12-31

7 737 120

Contract number: 1770425226117001177
Customer: МИНИСТЕРСТВО ОБОРОНЫ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subject: Транспортное средство военной автомобильной инспекции на базе Ford Focus

Conclusion date: 2017-11-13
Execution completion date: 2017-12-31

9 102 000

Contract number: 1772237786617000220
Customer: ФЕДЕРАЛЬНАЯ СЛУЖБА ВОЙСК НАЦИОНАЛЬНОЙ ГВАРДИИ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subject: Средства транспортные Ford Focus с двигателем с искровым зажиганием, с рабочим объемом цилиндров 1596 см³

Conclusion date:
2017-11-09
Execution completion date: 2017-12-25

8 329 260

Contract number: 1771005448317000100
Customer: ВЕРХОВНЫЙ СУД РОССИЙСКОЙ ФЕДЕРАЦИИ

Subjects: Автотранспортное средство тип 2: 22278С Автомобиль грузопассажирский, на базе шасси «Ford Transit» and 1 more

Conclusion date: 2017-08-23
Execution completion date: 2017-09-30

24 059 500

Contract number: 1770236131417000498
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ «ВОЙСКОВАЯ ЧАСТЬ 55056»

Subjects: Легковые автомобили с колесной формулой 4х4 NiSSAN X-Trail and 4 more

Conclusion date: 2017-08-16
Execution completion date: 2017-12-31

26 566 000

Contract number: 1771200512117000166
Customer: ОРДЕНА ТРУДОВОГО КРАСНОГО ЗНАМЕНИ ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ УНИТАРНОЕ ПРЕДПРИЯТИЕ «РОССИЙСКИЕ СЕТИ ВЕЩАНИЯ И ОПОВЕЩЕНИЯ»

Subject: Выполнение работ по сохранению первоначальных свойств и качеств продукции, находящейся у Заказчика

Conclusion date: 2017-07-26
Execution completion date: 2018-09-14

900 000

Contract number: 1770425226117000670
Customer: МИНИСТЕРСТВО ОБОРОНЫ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subject: Транспортное средство военной автомобильной инспекции на базе Ford Focus

Conclusion date: 2017-07-10
Execution completion date: 2017-12-31

18 204 000

Contract number: 1770236131417000301
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ «ВОЙСКОВАЯ ЧАСТЬ 55056»

Subject: Легковой автомобиль с колесной формулой 4х2 NISSAN Almera

Conclusion date: 2017-06-23
Execution completion date: 2017-12-31

729 300

Contract number: 1500906786617000054
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ «МНОГОФУНКЦИОНАЛЬНЫЙ КОМПЛЕКС МИНИСТЕРСТВА ФИНАНСОВ РОССИЙСКОЙ ФЕДЕРАЦИИ»

Subjects: Техническое обслуживание 45 тыс.км. and 4 more

Conclusion date: 2017-05-04
Execution completion date: 2018-02-19

35 757

Contract number: 57724068140170001280000
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ АВТОНОМНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ОБРАЗОВАНИЯ «НАЦИОНАЛЬНЫЙ ИССЛЕДОВАТЕЛЬСКИЙ ЯДЕРНЫЙ УНИВЕРСИТЕТ «МИФИ»

Subject: Услуги по обычному (текущему) техническому обслуживанию и ремонту легковых автомобилей и легких грузовых автотранспортных средств, кроме услуг по ремонту электрооборудования, шин и кузовов

Conclusion date: 2017-02-28
Execution completion date: 2017-12-31

250 000

Contract number: 1770607473717000011
Customer: МИНИСТЕРСТВО ВНУТРЕННИХ ДЕЛ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subjects: автомобильная техника: Автомобили грузовые с дизельным двигателем  FORD TRANSIT and 2 more

Conclusion date: 2017-02-06
Execution completion date: 2017-07-01

168 822 955

Contract number: 2402904010917000001
Customer: ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ КАЛУЖСКОЙ ОБЛАСТИ «АВТОХОЗЯЙСТВО АДМИНИСТРАЦИИ ГУБЕРНАТОРА КАЛУЖСКОЙ ОБЛАСТИ»

Subjects: Оказание услуг по диагностике, техническому обслуживанию и ремонту автотранспортных средств марки Форд: стоимость запасных частей and 1 more

Conclusion date: 2017-01-23
Execution completion date: 2017-12-31

2 000 000

Contract number: 3400900308117000001
Customer: АДМИНИСТРАЦИЯ (ИСПОЛНИТЕЛЬНО-РАСПОРЯДИТЕЛЬНЫЙ ОРГАН) ГОРОДСКОГО ПОСЕЛЕНИЯ «ГОРОД КОЗЕЛЬСК»

Subject: легковой автомобиль Ford Focus

Conclusion date: 2017-01-09
Execution completion date: 2017-03-31

911 333

Contract number: 3401600300417000002
Customer: АДМИНИСТРАЦИЯ (ИСПОЛНИТЕЛЬНО-РАСПОРЯДИТЕЛЬНЫЙ ОРГАН) ГОРОДСКОГО ПОСЕЛЕНИЯ «ГОРОД СПАС-ДЕМЕНСК»

Subject: Поставка легкового автомобиля

Conclusion date: 2017-01-09
Execution completion date: 2017-03-31

981 667

Contract number: 67723185941160000210000
Customer: АКЦИОНЕРНОЕ ОБЩЕСТВО «ЭНЕРГОСТРОЙСНАБКОМПЛЕКТ ЕЭС»

Subject: Услуги по оптовой и розничной торговле и услуги по ремонту автотранспортных средств и мотоциклов

Conclusion date: 2016-12-21
Execution completion date: 2017-12-21

200 000

Contract number: 57710142570160005770000
Customer: Федеральное государственное унитарное предприятие «Предприятие по поставкам продукции Управления делами Президента Российской Федерации»

Subject: Средства транспортные с двигателем с искровым зажиганием, с рабочим объемом цилиндров более 1500 см3, новые

Conclusion date: 2016-12-14
Execution completion date: 2016-12-15

1 000 000

Contract number: 67733022671160000990000
Customer: ПУБЛИЧНОЕ АКЦИОНЕРНОЕ ОБЩЕСТВО «РАДИОФИЗИКА»

Subject: Автомобили легковые

Conclusion date: 2016-12-08

1 633 500

Contract number: 1770236131416000887
Customer: ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ «ВОЙСКОВАЯ ЧАСТЬ 55056»

Subject: Автомобили CHEVROLET NIVA, 212300-55 на шасси легкового полноприводного автомобиля (колесная формула 4х4) для обучения вождению со вторым комплектом педалей

Conclusion date: 2016-12-08
Execution completion date: 2016-12-31

5 800 000

Contract number: 1631700727816000496
Customer: ФЕДЕРАЛЬНОЕ КАЗЕННОЕ УЧРЕЖДЕНИЕ «ПРИВОЛЖСКОЕ ОКРУЖНОЕ УПРАВЛЕНИЕ МАТЕРИАЛЬНО-ТЕХНИЧЕСКОГО СНАБЖЕНИЯ МИНИСТЕРСТВА ВНУТРЕННИХ ДЕЛ РОССИЙСКОЙ ФЕДЕРАЦИИ»

Subjects: Транспортное средство Ford Mondeo and 1 more

Conclusion date: 2016-12-02
Execution completion date: 2016-12-30

2 700 000

Contract number: 1770607473716000394
Customer: МИНИСТЕРСТВО ВНУТРЕННИХ ДЕЛ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subjects: Легковые автомобили   FORD EXPLORER, с рабочим объемом цилиндров 3496 см3, тип 1 and 1 more

Conclusion date: 2016-11-28
Execution completion date: 2016-12-25

193 394 020

Contract number: 1770607473716000396
Customer: МИНИСТЕРСТВО ВНУТРЕННИХ ДЕЛ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subjects: Легковые автомобили Ford Mondeo,с рабочим объемом цилиндров 2488 см3, тип 1 and 4 more

Conclusion date: 2016-11-28
Execution completion date: 2016-12-25

93 611 066

Contract number: 1770607473716000381
Customer: МИНИСТЕРСТВО ВНУТРЕННИХ ДЕЛ РОССИЙСКОЙ ФЕДЕРАЦИИ

Subject: Автобус FORD TRANSIT

Conclusion date: 2016-11-14
Execution completion date: 2016-12-25

134 220 750

Как доехать до Дженсер-Новоясенево в Ясенево на автобусе, метро, маршрутке или поезде?

Общественный транспорт до Дженсер-Новоясенево в Ясенево

Не знаете, как доехать до Дженсер-Новоясенево в Ясенево, Россия? Moovit поможет вам найти лучший способ добраться до Дженсер-Новоясенево от ближайшей остановки общественного транспорта, используя пошаговые инструкции.

Moovit предлагает бесплатные карты и навигацию в режиме реального времени, чтобы помочь вам сориентироваться в городе. Открывайте расписания, поездки, часы работы, и узнайте, сколько займет дорога до Дженсер-Новоясенево с учетом данных Реального Времени.

Ищете остановку или станцию около Дженсер-Новоясенево? Проверьте список ближайших остановок к пункту назначения: Новоясеневский просп.; Автоцентр Дженсер; Метро «Теплый Стан»; Метро Тёплый Стан.

Вы можете доехать до Дженсер-Новоясенево на автобусе, метро, маршрутке или поезде. У этих линий и маршрутов есть остановки поблизости: (Автобус) 264, 281, 781, С14, Т81 (Метро) 6 (Маршрутка) 894

Хотите проверить, нет ли другого пути, который поможет вам добраться быстрее? Moovit помогает найти альтернативные варианты маршрутов и времени. Получите инструкции, как легко доехать до или от Дженсер-Новоясенево с помощью приложения или сайте Moovit.

С нами добраться до Дженсер-Новоясенево проще простого, именно поэтому более 930 млн. пользователей доверяют Moovit как лучшему транспортному приложению. Включая жителей Ясенево! Не нужно устанавливать отдельное приложение для автобуса и отдельное приложение для метро, Moovit — ваше универсальное транспортное приложение, которое поможет вам найти самые обновленные расписания автобусов и метро.

Автоцентр Genser Ясенево отзывы, Москва, Новоясеневский пр., 6к2

Ирина

29 апреля 2020 в 12:07

Были в автоцентре «Хендэ». Здесь работают профессионалы. Внимательное отношение, достоверная информация, быстрое обслуживание. Спасибо!

Алиса

21 марта 2020 в 7:47

Устраняли коррозию на моем стареньком Ниссане. Качество отличное, стоимость тоже приятно порадовала. Сделали быстро. Я записывалась заранее. Сервис рекомендую, хорошие мастера

Елена

20 марта 2020 в 11:06

С ними уже как 3 года. Мастера внимательные, особенно Василий (руки золотые и помочь с советом не прочь)

Михаил

16 ноября 2019 в 21:00

Уже не первый год обслуживаюсь в Дженсер. Меня устраивают цены на услуги и то что сотрудники работают на совесть! Записываюсь всегда заранее, так как время расписано поминутно — у них много клиентов но соей машине всегда уделяют полное внимание

Руслан

14 ноября 2019 в 14:30

Уже 3 года как обслуживаюсь в этом центре — мне нравиться. Работают спецы на европейском оборудовании и заливают только качественное масло. Думаю это лучший сервис с нормальными ценами и обслуживанием по-человески

Михаил

23 октября 2019 в 22:24

Друзья, этот сервис как по мне самый нормальный. Ребята работают на профессиональной технике, Цены на услуги ниже чем у официалов!

Дарья

18 октября 2019 в 17:44

Ой, я в машинах вообще нечего не понимаю, ну я думаю я не одна такая). Заезжаю в Дженсер раз-два в полгода. На диагностику, менять шины по сезону или замену масел. Никогда нареканий на их работу не было. Работают четко и быстро.

Алекс

08 сентября 2019 в 1:19

Делали очередное ТО. Не довольны обслуживанием, сервисом, менеджером. Год назад был Дженсен ещё, было все отлично. Теперь претензий много и по мелочам, и в целом. Больше не обратимся.

Всеслав

21 июля 2019 в 22:21

Не ремонтируют и разводят на деньги на сервисе. Гарантийные случаи выдают за экспл. Износ.

Genser в Москве, Новоясеневский проспект, отзывы клиентов и рейтинг

Сервис: Saab, Opel, Chevrolet, Hummer, Cadillac и Chevrolet GM АВТОВАЗ

Ауди Центр Алтуфьево является крупнейшим в Восточной Европе официальным дилерским центром по продажам и обслуживанию автомобилей Audi.

Огромный пятиэтажный терминал удобно расположен на 85-м км внешней стороны МКАД.

Центр предоставляет полный спектр услуг по выбору, приобретению, обслу

Читать ещеживанию автомобилей и работает без выходных и праздничных дней с 9.00 до 21.00.

Полный модельный ряд автомобилей Audi, доступный российским покупателям, представлен в шоу-румах общей площадью более 8 000 кв.м.

Это единственный автоцентр в Москве, где можно во всем блеске увидеть спортивную линейку моделей бренда — Audi RS.

Клиенты центра могут также выбрать и приобрести практически любую модель в рамках программы Audi с пробегом :plus, в которой участвуют автомобили не старше 5 лет с пробегом не более 100 000 км, прошедшие тщательный отбор и получившие гарантию на 12 месяцев со дня покупки.

В Ауди Центре Алтуфьево можно выбрать любой автомобиль из имеющихся в наличии или заказать в производство, получить профессиональные консультации специалистов, определиться в выборе на тест-драйве, подобрать кредитную программу и выгодный тариф страхования, а также воспользоваться услугой trade-in.

Сервисная зона Ауди Центра Алтуфьево занимает 2 000 кв.м и оснащена новейшим оборудованием, соответствующим всем стандартам и техническим требованиям бренда.

10 действующих постов, 10 подъемников позволяют оперативно проводить техническое обслуживание, выявлять и устранять любые проблемы. Кроме того, в техническом центре есть все необходимое для установки дополнительного оборудования. Клиенты сервиса крупнейшего европейского дилерского центра Ауди не знают, что такое очередь на техническое обслуживание и ремонт.

Клиентам Ауди Центра Алтуфьево доступна VIP-программа обслуживания, включающая услуги выделенного специалиста, круглосуточную техническую помощь на дороге, бесплатную эвакуацию автомобиля в случае поломки, предоставление подменных автомобилей и многое другое.

В числе других преимуществ автосалона – уютное кафе, вызов такси для клиентов сервиса, а также прием автомобиля в сервис в день обращения.

  • Марки авто

    Opel, Cadillac, Chevrolet, Hummer, Saab

  • Наши услуги

    Автозвук, Автостекла, Кузовной ремонт, Техническое обслуживание, Тюнинг, Электрика

  • Методы оплаты

  • Дополнительные услуги

    • Мойка
    • Выезд к клиенту
    • Склад/запчасти

Дженсер Ясенево: Опель покоряет пространство

Ежегодный рост количества автолюбителей  увеличивает потребность в авторитетных автосалонах, к которым относится Дженсер Ясенево. Опель наряду с другими мировыми брендами имеет большую популярность у автолюбителей, благодаря новшествам, которые постоянно присутствуют в различных моделях.

Любой покупатель сам может убедиться в профессионализме и в высоком уровне сотрудников компании Дженсер в Ясенево. Дилер Опель — Дженсер реализует популярный автомобиль по многим программам, которые делают фирменную машину доступной абсолютно для всех.

Дженсер Ясенево: Опель расширяет границы

Купить современный автомобиль, который станет для автовладельца настоящей реальностью, возможно в компании  Дженсер Ясенево. Опель реализуется здесь часто и успешно, так как предложенные выгодные программы делают автомобиль доступным для всех категорий населения.

Все без исключения модели Опель в компании Дженсер Ясенево Опель предлагаются по следующим программам:

  • автокредиты, варианты которых выгодны всем;
  • выгодные рассрочки;
  • оформление корпоративных программ;
  • обмен по программе trade-in;
  • прокат или аренда;

Для сотрудников компании Дженсер Ясенево важно, чтобы у покупателей Опель не было никаких проблем с оформлением страховки или регистрации в ГИБДД. Юристы компании сделают всё оформление быстро и качественно.

Дилер Опель: Дженсер выходит в лидеры

Всем известно, что автомобиль требует ухода, обслуживания и технической поддержки, который предлагает дилер Опель. Дженсер подключил ко всем программам сервисного и технического обслуживания.

В качестве дополнительных услуг  дилер Дженсер предлагает следующие виды технического сопровождения Опель:

  • слесарный и кузовной ремонт;
  • шиномонтаж и балансировку;
  • полную и локальную покраску кузова;
  • установку дополнительных аксессуаров;
  • тюнинг, тонировку;
  • гарантийный и постгарантийный ремонт;
  • диагностику основных узлов и деталей;
  • техническую помощь на дорогах столицы;
  • вызов эвакуатора;

Сотрудники  дилера Дженсер рекомендуют всем заинтересованным лицам посетить сайт и приобрести Опель по выгодным предложениям. Кроме того, на сайте есть полная информация о ценах, поступивших моделях, цвете и комплектации автомобилей.

Для компании важно осознавать, что главным принципом работы с клиентом является индивидуальный подход, сотрудничество и партнёрство.

Новые работы скульптора Джиллиан Дженсер из Торонто изображают нашу связь с окружающей средой и друг друга.

Скульптор из Торонто Джиллиан Дженсер создает Ла Пьета (справа). Ее грудь покрыта ракушкой, а сложное брюшко выполнено с прожилками коряг. Слева — ее череп. Джиллиан Генсер / Раздаточный материал

Чтобы по-новому взглянуть на мир, особенно на тот, в котором мы живем, мы можем взглянуть на искусство, которое нас окружает. В моем случае мне нужно было только смотреть через улицу.

Моя соседка, Джиллиан Дженсер, всегда приветствовала меня с распростертыми объятиями в своей студии.Пространство похоже на загадочный музей: шкафы и столешницы загромождены образцами плавников, костей, раковин и кораллов, которые она собирала за долгие годы. Это нервирует, когда тебя окружает столько всего, что когда-то было живым.

Впервые я встретил скульптора много лет назад, когда она постучала в нашу дверь в Этобико, Онтарио, чтобы поговорить о защите ясеня на нашей улице. Ее сад местных растений выделяется как самый очаровательный в нашем квартале. Иногда она роется в нашем районе — она ​​может попросить нас не использовать химикаты для осиновых гнезд, чтобы зимой использовать брошенный панцирь.В других случаях она находит новый материал у поставщиков, пользующихся этическими принципами.

Когда мы познакомились, я не знал, что она художник, я просто знал, что она заботится о деревьях. Но, как я узнал, ее работы получили международную известность и были включены в школьные программы как в США, так и в Бразилии.

Скульптуры г-жи Дженсер вдыхают дух в останки жизни. Ее творения отображают нашу связь с окружающей средой и, в конечном итоге, нашу связь друг с другом. Они сложны и созданы для изучения; под г-жойПод руководством Дженсер, я мог оценить всю их глубину, пока она разбирала части.

Женщина, изображение матери-природы на коленях, держащей свое слабое тело. Раздаточный материал

«Когда мы пытаемся понять жизнь, это означает, что мы пытаемся понять смерть», — фактически говорит она мне. Ей чуть больше шестидесяти, она связывает темные волосы и осторожно подбирает слова. «Сегодня хороший день», — сказала она мне, имея в виду, что у нее ясная голова. Ее работа отчасти является комментарием к ее собственному состоянию, неврологической борьбе, которая, в свою очередь, была вызвана ее искусством.

Быть свидетелем ее работ было деликатным делом, особенно сейчас, когда ее искусство не может быть доступно широкой публике.

Я помню ее волнение пару лет назад, когда она впервые нашла на продажу рога антилоп гну, текстурированные и скрученные с кривизной, напоминающей ноги на коленях. Они идеально подошли бы для ее следующей скульптуры, которую она назвала бы Ла Пьета.

Дыхательная, репродуктивная и кровеносная системы создания сделаны из натуральных материалов, таких как кости и экзоскелеты.Сундук покрыт ракушкой, но посмотрите за нее, и вы увидите сложное брюшко, сделанное из прожилок коряг. Дизайн скульптуры позволяет зрителю вглядеться в тело и увидеть органы Ла Пьеты.

Отключенная голова скульптуры смотрит на собственное тело. Ее легкие сделаны из носовых ходов ягненка, что намекает на воскресение. Ее матка содержит останки пчелы, символ плодородия земли. Ее волосы — осиное гнездо, а сердце — пчелиный улей: тонкие последние послания суеты и бодрости.

Мисс Дженсер создала женщину: изображение Матери-природы на коленях, держащей в руках свое слабое тело.

Разъединенная голова скульптуры смотрит на собственное тело. Раздаточный материал

«Но, возможно, она тоже все мы, смотрящие с сожалением и сожалением на несправедливость и жестокость, совершаемые в теле всего человечества», — объясняет она, кивая в сторону. прошлый год. Скульптура изображает всех нас, пытающихся найти сочувствие, в то время как мы, возможно, разваливаемся по швам.

Но г-жаДженсеру знакомы самоизоляция и болезни — две вещи, которые больше всего изменили наше существование с начала пандемии.

Ее работы стали популярными в 2018 году — в частности, скульптура по имени Адам, созданная из раковин мидий. В результате его создания она теперь живет с отравлением тяжелыми металлами.

Она начала работать над Адамом в 1998 году и провела 15 лет, просеивая тысячи раковин в поисках идеальных, которые соответствовали бы полосатости мускулов его тела, затем измельчила и сформировала их.

Но раковины — это пример биоаккумулирующего организма. В частности, мидии накапливают в своих тканях токсины и химические вещества. Годы работы с ними позволили таким металлам, как мышьяк и свинец, проникнуть в ее поры и легкие. Сейчас она страдает неврологическим повреждением, значительной потерей слуха и необратимыми изнурительными последствиями для психического здоровья.

«Я чувствую, что с каждым произведением я получаю наследство их жизни. Они отдают его мне. Это болезненный подарок, но это подарок.И он был первым, поэтому я получила от него первое болезненное наследство », — говорит она.

Неумышленно она стала частью своей работы, а ее работа стала частью ее.

«Я разрешаю останкам дать мне свой голос, — говорит она, — и им есть что сказать».

La Pieta, созданная скульптором из Торонто Джиллиан Генсер, полностью сделана из натуральных материалов, от рогов антилоп гну для ее ног до осиного гнезда для волос. Работа г-жи Дженсер сделана с целью изучения, позволяя вам заглянуть внутрь Ла Пьеты и обнаружить, что остальные органы фигуры сделаны из других найденных материалов.Видео предоставлено Джиллиан Дженсер.

Раздаточный материал

Четыре выпускника HKS были названы молодыми глобальными лидерами

Всемирный экономический форум выбрал четырех выпускников HKS в качестве членов своего класса молодых глобальных лидеров 2021 года, который включает 112 лидеров из бизнеса, гражданского общества, здравоохранения и правительства. Эти выпускники присоединяются к 36 выпускникам программ HKS, получившим звание YGL с момента создания программы в 2004 году. Всемирный экономический форум, основанный в 1971 году Клаусом Швабом MC / MPA 1967, является международной неправительственной организацией, которая поощряет сотрудничество между государственным и частным секторами. .

выпускников HKS, которые являются YGL на 2021 год, включают Питера Биара Аяка MPA / ID 2009, Анн-Лор де Шаммар MPP 2009, Газаль Калра MPA 2014 и Роберто Патиньо MPP 2015.

Биар Аджак MPA / ID 2009 — лидер гражданского общества, политический диссидент и ученый из Южного Судана, выступающий за права человека и свободные и справедливые выборы. В 2018 году, когда он защищал докторскую диссертацию в Кембриджском университете, он был задержан и осужден в ходе политически мотивированного судебного процесса и заключен в тюрьму на 18 месяцев в печально известной тюрьме Голубой дом Южного Судана.В январе 2020 года международный адвокат по правам человека Джаред Генсер MPP 1998 HKSEE 2009 добился его освобождения, а тем летом помог Аджаку и его семье сбежать из отряда смерти, приказанного президентом Южного Судана. Аджак — научный сотрудник Рейгана-Фаселла по вопросам демократии в Национальном фонде за демократию, научный сотрудник архиепископа Десмонда Туту, стипендиат тысячелетия Атлантического совета и приглашенный научный сотрудник Африканского центра стратегических исследований Университета национальной обороны. Он также является председателем Форума молодых лидеров Южного Судана, старшим советником Международного центра роста Лондонской школы экономики и основателем Центра стратегического анализа и исследований в Джубе.Ранее он был старшим советником министра национальной безопасности в канцелярии президента Южного Судана и экономистом Всемирного банка по стране.

Anne-Laure de Chammard MPP 2009 — руководитель группы по стратегии и инновациям в ENGIE Group, организации с 170 000 сотрудников, которая обеспечивает низкоуглеродную энергию и услуги для решения чрезвычайных ситуаций, связанных с изменением климата. Она начала свою карьеру в Boston Consulting Group, затем присоединилась к Министерству устойчивого развития и энергетики Франции, где руководила крупными инфраструктурными проектами государственно-частного партнерства.В 2014 году де Шаммар присоединилась к Bureau Veritas Group в качестве генерального менеджера по Восточному региону Франции, а в 2016 году стала президентом и главным исполнительным директором Bureau Veritas Construction. В 2019 году она присоединилась к ENGIE, чтобы возглавить стратегию группы по переходу на нулевой углерод. Она также увлечена оперой, она записывалась и пела на концертах.

Gazal Kalra MPA 2014 соучредителем Rivigo в 2014 году. Компания — стартап в области технической логистики в Индии, цель которого — сделать логистику более человечной, быстрой, безопасной и более эффективной — использует «ретрансляционные грузовые перевозки» для решения проблемы нехватки водителей грузовиков. а также предоставить рабочие места в отдаленные районы, помогая водителям грузовиков проводить меньше времени в дороге и больше проводить с семьями.В 2019 году Fortune India включила Калру и ее соучредителя в свой список «40 до 40». Она начала свою карьеру в McKinsey & Co. и занимала должности в Фонде общественного здравоохранения Индии, Группе Всемирного банка и Парламенте Индии.

Роберто Патиньо MPP 2015 — венесуэльский социальный предприниматель, борец за демократию и права человека. Он основал две неправительственные организации, в том числе Mi Convive, цель которой — разорвать порочный круг насилия и мести в Каракасе, и Alimenta la Solidaridad, которая помогает малообеспеченным семьям прокормить своих детей. Венесуэла ухудшилась.Патиньо, эксперт в области безопасности граждан, ведения переговоров и разрешения конфликтов, является членом правления Primero Justicia, политической партии, и Bangente, банка развития. Он бывший лидер студенческого движения Венесуэлы.

Портсмут, Вирджиния Ежедневная сводка

Портсмут, Вирджиния Ежедневная сводка

Сегодня в Портсмуте!



The Great Nor’easter 1998
3-5 февраля 1998 г.

Хотя PWRS находится на этом месте всего 22 года, его основатель находится в этом районе уже 44 года.В то время великая буря Пепельная среда 1960-х годов была самым сильным продолжительным ветром и наводнением. С тех пор норд-пасхи приходили и уходили, но нынешний, вероятно, второй по серьезности по сравнению с Бурей Пепельной среды.

День начался со строительного ветра с востока и юго-востока. К середине утра ветер дул до 70 миль в час в туннеле моста через Чесапикский залив с меньшими порывами, когда кто-то двигался на запад от туннеля. Ветер здесь, в Портсмуте, дул со скоростью 48 миль в час с юго-востока в 11:45 EST.До конца дня продолжались сильные восточные ветры.

Полосы ливней двинулись сначала с юга, затем с юго-юго-востока на закате с шквалистой погодой в то время. Между 16:35 и 17:10 над станцией прошла молния из облака на землю. Количество осадков за день составило 3,86 дюйма, а добавление к предыдущему количеству за день привело к сумме шторма 4,03 дюйма.

Продолжительные, устойчивые береговые ветры и проливные дожди в совокупности привели к умеренным наводнениям во второй половине дня в подверженных наводнениям районах Хэмптон-Роудс, включая Песчаный мост на восточном берегу Вирджиния-Бич и низменные районы вокруг притоков рек Норфолк и Портсмут.Сильное наводнение должно было произойти в четверг утром с уровнем наводнения примерно на 7,1 фута выше средней отметки минимума воды, что вызвало сильное наводнение в обычных районах.

Большинство школ было закрыто, а некоторые школы, расположенные в глубине страны, открылись с задержкой.


Среда, 4 февраля 1998 г .: Высокая температура была на 51,2 ° на 1 ° выше нормы и произошла в 16:00.
Низкая температура была 45,6 °, на 14 ° выше нормы и возникла в 8:00 утра.
Средняя температура составила 48. 5 °, что на 7 ° выше нормы
Градус нагрева дней = 16.5

Степень охлаждения в днях = 0,0
Ежедневное количество осадков = 3,86 дюйма
Наивысшая относительная влажность = 97% в 23:59

Самая низкая относительная влажность = 92% в 00:01
Барометр: максимум 29,798 дюйма в 12: 01:00 Минимум 29,198 дюйма, 21:00
Максимальный порыв ветра составил 48 миль в час в юго-восточном направлении в 11:45.

Returnto PWRS ‘База данных Страница

Returnto PWRS’ Домашняя страница

Сын требует от Ирана освободить больного отца для оказания срочной медицинской помощи

ВАШИНГТОН (AP) — сын американца иранского происхождения, который содержится в Иране более пяти лет. Годы потребовали немедленного освобождения его отца в понедельник, чтобы он мог получить неотложную и потенциально жизненно важную операцию.

Бакеру Намази, 84 года, требуется операция в течение нескольких дней, чтобы устранить серьезную закупорку главной артерии, которая снабжает кровью его мозг, по словам его сына Бабака и адвоката семьи Джареда Генсера.

«Мой отец уже потерял столько драгоценного времени. Я умоляю Иран позволить ему проводить оставшееся у него небольшое количество времени со своей семьей », — сказал Бабак Намази репортерам в понедельник, призвав Иран отменить запрет на поездки, из-за которого его отец оставался в стране.

Намази-старший, бывший представитель ЮНИСЕФ и имеющий двойное гражданство США ирано-американского происхождения, был задержан в 2016 году, когда он ехал в Тегеран, чтобы увидеться со своим сыном Сиамаком Намази, бизнесменом, арестованным в Иране несколькими месяцами ранее. Оба намази были приговорены к 10 годам тюремного заключения в Иране по сфабрикованным обвинениям в шпионаже.

Бакеру Намази был предоставлен отпуск по медицинским показаниям в 2018 году, и его приговор был впоследствии заменен отбытием срока, но иранские власти не разрешили ему покинуть страну.Сиамак Намази по-прежнему находится в печально известной иранской тюрьме Эвин, и Бабак Намази в понедельник повторил свои требования об освобождении своего брата.

Врачи Бакера Намази сказали, что ему нужна операция в течение семи-десяти дней, чтобы избежать потенциально катастрофического инсульта, сказал его сын. Сторонники Намази заявили о своих требованиях Ирану, но также добиваются прямого вмешательства со стороны Белого дома президента Джо Байдена.

Команда юристов обратилась за помощью в понедельник в U.Н. Специальный докладчик по вопросу о праве на здоровье пишет в подробном документе, что «из-за серьезности его медицинских проблем Бакер особенно сталкивается с высоким риском смерти, если Иран быстро не изменит курс».

«Время для максимальных усилий прошло», — сказал Генсер репортерам. «Пришло время действовать».

Позже в тот же день официальный представитель Госдепартамента Нед Прайс заявил, что администрация Байдена неоднократно выражала Ирану озабоченность по поводу «американцев и других иностранных граждан, которых несправедливо удерживают против их воли.А госсекретарь Энтони Блинкен написал в Твиттере, что Иран должен позволить Намази «обратиться за медицинской помощью, необходимой для спасения его жизни».

Блинкен добавил: «Прошло почти шесть лет с тех пор, как он видел своих детей. В такое время его должна окружать вся его семья ».

Защитники Намази-старшего говорят, что они отчаянно нуждаются в том, чтобы его лечили за пределами Ирана, учитывая, насколько перегружены больницы лечением пациентов с COVID-19 и риск, который представляет для его здоровья.По словам Бабака Намази, если ему не разрешат уехать в течение нескольких дней, его отцу придется пройти операцию в Иране — сценарий далеко не идеальный.

«Если между ним и смертью, и не смертью, конечно, это вариант», — сказал Бабак Намази.

___

Следите за сообщениями Эрика Такера в Twitter: http://www.twitter.com/etuckerAP

BERTRAND, ELIETTE M. (DUBE) — Хартфорд Курант

BERTRAND, Элиетт М.(Дубе)

Элиетт М. (Дубе) 76-летняя Бертран из Манчестера, любимая 50-летняя жена Поля Бертрана, мирно скончалась в своем доме в четверг (24 ноября 2005 г.). Родилась в Сент-Ноэле, Квебек, Канада, она была дочерью покойного Пьера и Мари-Анны (Родительницы) Дюбе. Она иммигрировала в Соединенные Штаты в 1951 году, а затем стала гражданином США в 1966 году. В последнее время она жила в Манчестере, а до этого много лет жила в Гластонбери. Чтобы сохранить теплые воспоминания о своей жизни, она оставляет позади своего мужа Пола; ее сын, Стивен и его жена, Марта и их дети, Шейла, Остин и Коул.Дочь, Морин и ее муж, Стефан Сент-Аманд и их дети, Захари, Тайлер и Люк. И сын Карл Бертран из Манчестера. Она нашла счастье в своих внуках, сыгравших значительную роль в ее жизни, которые нежно называли ее «Мими». Она также оставляет после себя пять сестер: Бриджит и ее муж Луи Левеск, Попун и ее муж Раймон Отис, Шарлотту и ее муж Дени Рикар, Люсиль и ее муж Роджер Лепин, Полин Дьюб; и брат Жиль Дюбе и его жена Люсетт из Квебека, Канада; и его зятья и невестки, Патрик и Алиса Бертран из Ньюингтона, Клодетт и Марсель Друэн из Восточного Хартфорда.Она также оставляет после себя племянников и племянников, которых слишком много, чтобы упоминать их по имени. До выхода на пенсию она много лет была казначеем компании Central Drywall. Она была активным членом ассоциации Canado-Americaine. Помимо времяпровождения с семьей, ее любимым занятием было шитье. Семья хотела бы выразить особую благодарность доктору Стюарту Гензеру, доктору Джону Руссомано и Ди Рендок, APRN, которые предоставили ей комфорт и заботу. Друзья и семья могут зайти в похоронное бюро Mulryan, 725 Hebron Ave., Гластонбери, понедельник, 28 ноября, с 14 до 16 и с 19 до 21. Христианская месса состоится во вторник, 29 ноября, в 10 часов утра в церкви Святого Данстана, 1345 Манчестер Роуд, Гластонбери. Похороны будут совершены на кладбище Святого Креста в Гластонбери. Мемориальные взносы могут быть сделаны в American Lung Assoc., 45 Ash St., East Hartford 06108, или в American Diabetes Assoc., 306 Industrial Park Rd., Suite 105, Middletown CT 06457.

Трансплантация пуповинной крови и цитомегаловирус : посттрансплантационная инфекция и скрининг доноров | Кровь

Несмотря на эффективную противовирусную терапию, цитомегаловирус (ЦМВ) остается одной из ведущих причин заболеваемости и смертности после трансплантации гемопоэтических стволовых клеток (ГСК). 1,2 ЦМВ-инфекция у реципиентов трансплантата может возникать в результате реактивации латентной инфекции или в результате вновь приобретенных инфекций с донорской кровью, тканью или органами в качестве источника вируса. 3,4 Таким образом, правила Управления по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) в отношении соответствия критериям отбора доноров требуют тестирования доноров жизнеспособной, богатой лейкоцитами крови и HSC на «доказательства инфекции, вызванной цитомегаловирусом». 5 Для доноров стволовых клеток костного мозга или периферической крови скрининг основывается на традиционных серологических методах обнаружения ЦМВ-общих антител, поскольку их присутствие (обнаруженное более чем у половины взрослых доноров костного мозга в США) указывает на активное или латентная инфекция, любая из которых может передаваться реципиентам трансплантата. 6,7 Пуповинная кровь (CB), все более распространенная альтернатива трансплантатам костного мозга, имеет низкий риск передачи ЦМВ из-за низкой частоты врожденной ЦМВ-инфекции (сообщается в 0,2–2,5% США). рождений). 8-10 Однако на сегодняшний день ни в одном исследовании не проводилась систематическая оценка риска ЦМВ-инфекции у реципиентов трансплантата ХБ или оценивалась эффективность методов скрининга доноров ХБ в этом контексте.

Варианты скрининга на ЦМВ для доноров ХБ включают (1) серологическое тестирование матери младенца-донора для выявления риска инфекции у младенца, (2) серологическое тестирование ХБ ребенка, (3) обнаружение инфекции у младенца вирусным путем. культура или ДНК-специфическая полимеразная цепная реакция (ПЦР) ЦМВ для обнаружения последовательностей нуклеиновых кислот ЦМВ или (4) комбинация серологического тестирования и выявления инфекции у младенца.Интерпретация данных, полученных только серологическими методами, у доноров ХБ затруднена из-за активного транспорта материнских антител IgG через плаценту. Таким образом, положительный результат на ЦМВ – общие антитела у матери или при ХБ обычно отражает воздействие ЦМВ на всю жизнь матери и потенциальный риск, но не обязательно инфицирование младенца. Антитела CMV – IgM (IgM anti-CMV) у матери во время рождения ребенка, как маркер недавней активной инфекции CMV, должны указывать на повышенный риск инфицирования младенца.В некоторых исследованиях сообщается, например, что до одной трети матерей с первичной инфекцией ЦМВ во время беременности передают вирус плоду. 11 IgM anti-CMV остается обнаруживаемым только в течение 4–6 месяцев, поэтому тестирование матери во время родов обычно не позволяет выявить инфекции, которые произошли на ранних сроках беременности. Более того, младенцы могут заразиться ЦМВ, когда латентная материнская инфекция реактивируется во время беременности, и анти-ЦМВ IgM у этих матерей могут оставаться отрицательными или быть положительными только на короткое время.Учитывая эти ограничения, может быть неоправдано, что некоторые банки CB принимают или исключают единицы CB на основании статуса матери по CMV-IgM. 12 Выявление ЦМВ-инфекции у младенца может быть предпринято более непосредственно, путем тестирования крови ребенка на антитела IgM, культивирования мочи или слюны на наличие вируса или тестирования крови, мочи или слюны на ДНК ЦМВ путем амплификации нуклеиновых кислот. Однако антитела IgM не обнаруживаются у большинства инфицированных младенцев. 10 Хотя выделение вируса путем посева мочи или слюны считается золотым стандартом для выявления врожденной ЦМВ-инфекции, культивирование вируса может быть обременительным и дорогостоящим и поэтому может оказаться непрактичным для крупномасштабного скрининга. 13 Полимеразная цепная реакция (ПЦР) может обнаруживать ДНК ЦМВ у врожденно инфицированных младенцев, но не была широко оценена для скрининга CB. 14,15

Мы провели текущее исследование для оценки частоты посттрансплантационной ЦМВ-инфекции у реципиентов ХБ, сданных в Национальную программу пуповинной крови (NCBP) Нью-Йоркского центра крови (NYBC), и актуальности серологических тестов доноров у матери как индикаторов риска ЦМВ. передачи реципиентам, а также для оценки возможных стратегий выявления доноров ХБ, инфицированных ЦМВ.

Антитело

IgM к CMV (IgM anti-CMV) было обнаружено с помощью иммуноферментного анализа микрочастиц (MEIA, система IMx; Abbott Laboratories, Abbott Park, IL). В соответствии с инструкциями производителя результаты были разделены на отрицательные, сомнительные или положительные. Материнская плазма, собранная до марта 2002 г., регулярно тестировалась на анти-CMV IgM (n = 11 726). Общие антитела к ЦМВ (общие анти-ЦМВ) в материнской плазме определяли с помощью твердофазного иммуноферментного анализа (ИФА) на IgG, IgM и IgA (ABBOTT CMV TOTAL AB EIA; Abbott Laboratories).Все матери, родившие в период с февраля 1993 г. по ноябрь 1997 г. и с июня 2001 г. по сентябрь 2005 г., были протестированы на общий анти-ЦМВ (n = 19 757). В дополнение к рутинному анализу образцы от матерей, чьи младенцы были положительными или были отобраны в качестве контроля в исследованиях случай-контроль, а также от матерей младенцев, чей CB был использован для трансплантации, были ретроспективно протестированы на IgM и общий анти-CMV, если еще не регулярно тестируется. Предполагалось, что матери, которые были положительными по общему анти-CMV, но отрицательными по IgM анти-CMV, имели преимущественно антитела IgG и в дальнейшем называются «положительными по IgG».«Те, у кого были обнаружены IgM анти-CMV, назывались« IgM-положительными ». Титр антител к ЦМВ определяли на основании положительности конечной точки при 2-кратных серийных разведениях. Единицы CB от матерей с IgM или IgG анти-CMV не исключались из инвентаризации.

В период с августа 1993 г. по декабрь 2004 г. 1564 пациентам была проведена трансплантация с использованием отдельных аппаратов CB, предоставленных NCBP. Центры трансплантации сообщили характеристики пациентов и данные об исходах для 1490 (95%), из которых 1279 имели данные как о предтрансплантационном статусе анти-ЦМВ, так и о посттрансплантационной ЦМВ-инфекции.Отчеты о результатах, включая информацию о посттрансплантационной инфекции, обычно получают через 3, 6 и 12 месяцев после трансплантации, а затем ежегодно. Среди них 1221 имели результаты материнского анти-CMV донора и были оценены на предмет доказательства их связи с частотой посттрансплантационной инфекции CMV у реципиентов CB. Анти-ЦМВ-статус реципиента до трансплантации был классифицирован как положительный, отрицательный или неоценимый. В последнюю категорию вошли пациенты с наследственными иммунодефицитными заболеваниями или перенесшие трансплантацию в первые месяцы жизни, когда положительные антитела, скорее всего, имели материнское происхождение.Предполагалось, что пациенты, чьи антитела к ЦМВ не были оценены до трансплантации, ранее не были инфицированы ЦМВ, и были сгруппированы вместе с пациентами с отрицательными антителами при анализе результатов трансплантации. Большинство центров трансплантации проводят мониторинг ЦМВ-инфекции путем еженедельного тестирования реципиентов на антигенемию или, в последнее время, на ДНК ЦМВ с помощью ПЦР до дня +100 и дольше, если у реципиента диагностирована острая болезнь трансплантат против хозяина (РТПХ). В этом исследовании посттрансплантационная инфекция ЦМВ определялась как любой положительный тест на антигенемию или ДНК ЦМВ с началом в качестве даты первого обнаружения (зарегистрировано в 90% случаев).ЦМВ-инфекция была далее классифицирована как легкая при обнаружении только в крови или как более тяжелая при обнаружении в других тканях или органах или связанная с заболеванием.

Отобранные праймеры для «собственной» ПЦР были направлены в область гликопротеина B (GlyB) из генома CMV человека длиной 280 п.н. 19 Экстрагированную ДНК (10 мкл) добавляли к смеси для ПЦР (25 пмоль каждого праймера, 1 × буфер для ПЦР [10 мМ Трис-HCl, pH = 8; 50 мМ KCl; 10 мМ NaCl], 6 мМ MgCl. 2 , Taq Gold, 5U [Perkin Elmer, Norwalk, CT], dUTP 1 × [Sigma, St Louis, MO], бычий сывороточный альбумин [BSA; 0.2 мг / мл; Roche, Indianapolis, IN] и ДНК-гликозилазы урацила [0,25 ед.]), Чтобы получить конечный объем 50 мкл. Амплификацию проводили в термоциклере Gene Amp 9600 (Perkin Elmer, Shelton, CT) следующим образом: выдержка при 25 ° C и 94 ° C в течение 10 минут, соответственно, с последующими 40 циклами при 94 ° C, 56 ° C, и 72 ° C в течение 40 секунд каждый. В конце реакции проводили цикл выдержки при 72 ° C в течение 5 минут.

Отрицательный, положительный и холостой контроль были включены в каждую реакцию.Отрицательным контролем были здоровые взрослые, у которых была отрицательная серология на ЦМВ, а пустой контроль состоял из стандартных реагентов ПЦР без образца ДНК. CMV-положительные контроли с высоким и низким уровнем копий (vc) получали из исходного материала (10000 vc / мкл; Advanced Biotechnologies; Columbia, MD). Продукты ПЦР визуализировали электрофорезом в геле бромистого этидия через 2% агарозу в буфере 1 × TBE (1 М Трис, 0,9 М борная кислота, 0,01 М ЭДТА; Invitrogen, Карлсбад, Калифорния) и подтверждали гибридизацией со специфическими зондами.Для обнаружения образцов, содержащих ингибиторы ПЦР, последовательность ДНК (общий HLA-DRB1; 240 п.н.), которая не имеет гомологии с CMV, была коамплифицирована в качестве контрольной мишени с использованием мультиплексной ПЦР вместе с праймерами для CMV. Чтобы прогон считался действительным, должен присутствовать контрольный диапазон DRB1. Образец без амплификации праймеров CMV в допустимом опыте был интерпретирован как отрицательный CMV-PCR.

Для вложенной ПЦР 2 мкл продукта ПЦР добавляли к смеси, содержащей 0.36 мкМ каждого праймера, 1 × буфер для ПЦР, 6 мМ MgCl 2 , Taq Gold, 5U (Perkin Elmer, Norwalk, CT), BSA (0,2 мг / мл; Roche) и dUTP 1 × (Sigma) в 50 Конечный объем мкл. Конкретные последовательности праймеров, внутренние по отношению к исходным последовательностям GlyB длиной 280 п.н., были следующими: прямой 5’aggtgctgcgtgatatgaacg3 ‘и обратный 5′-gacaacgaaatcctgttgggc-3’. Амплификацию ДНК проводили следующим образом: выдержка при 94 ° C в течение 10 минут, затем 25 циклов при 94 ° C, 56 ° C и 72 ° C в течение 30 секунд и цикл выдержки при 72 ° C в течение 5 минут.

Продукт ПЦР

оценивали гибридизацией с использованием 5′-биотинилированных специфических зондов (Qiagen, Бостон, Массачусетс) с сигналом, полученным с использованием хемилюминесцентной системы (ECL; Amersham Pharmacia Biotech, Бакингемшир, Англия). Каждая мембрана содержала 10-кратные разведения коммерческого положительного контроля ДНК ЦМВ (диапазон 1-5000 об.), А также отрицательного и холостого контролей, как описано выше.

Характеристики реципиентов трансплантата вместе с их серологическим статусом по ЦМВ до трансплантации показаны в таблице 1.Распространенность ЦМВ-антител увеличивалась с возрастом пациентов и чаще встречалась у реципиентов, которые не были белыми, и у пациентов, перенесших трансплантацию в центрах за пределами США или недавно перенесших трансплантацию. Более низкая распространенность среди пациентов с генетическими заболеваниями отражает их более молодой возраст, тогда как более высокая распространенность антител среди пациентов, недавно перенесших трансплантацию, отражает увеличение доли пожилых реципиентов в последние годы. Не было никакой связи между серологией CMV пациента перед трансплантацией и серологией CMV матери донора CB (данные не показаны).Всего в первый год после трансплантации было зарегистрировано 221 инфекцию ЦМВ. Частота ЦМВ-инфекции составила 23% в целом, 8% среди пациентов, у которых не было обнаружено антител против ЦМВ или которые не были оценены до трансплантации, и 41% среди пациентов с положительными антителами ( P <0,001). В пределах этих 2 категорий пациентов не было никакой связи между статусом материнских антител к ЦМВ у донора ХБ и частотой посттрансплантационной инфекции ЦМВ (рис. 2A-B). Заболеваемость ЦМВ-инфекцией после трансплантации была связана с серологией ЦМВ перед трансплантацией реципиента, этнической принадлежностью, возрастом, несоответствием HLA, центром трансплантации и годом трансплантации, но не с серологией доноров по материнской ЦМВ.В многофакторном анализе возраст реципиента больше не был значимым, а серологические данные по материнскому ЦМВ донора оставались незначительными (таблица 2). Из трансплантированных единиц CB 2 были положительными с помощью CMV-PCR: в 1 случае донор имел положительный результат посева слюны, и общий анти-CMV у матери был положительным, но IgM был отрицательным. У серонегативного реципиента была инфекция ЦМВ на +45 день после трансплантации, которая разрешилась после лечения ганцикловиром. Во втором случае материнский IgM анти-CMV был положительным, но посев слюны не проводился.Реципиент в этом случае был серопозитивным до трансплантации и умер от бактериального сепсиса на 52-й день, не выявив ЦМВ-инфекции до момента смерти. Все другие единицы CB, предоставленные для трансплантации исследуемым реципиентам, были отрицательными по результатам ПЦР. Удаление 2 реципиентов, получивших CB, которые были положительными по CMV-PCR, не повлияло существенно на результат многофакторного анализа (данные не показаны).

Таблица 1.

Характеристики реципиента пуповинной крови и серология на ЦМВ перед трансплантацией

9019 902 9025 001 02 89 0 902 902 902 902 902 902 902 902 902 902 902 902 902 902 907 .001

902

902 47,3

.

.

Серология перед трансплантацией
.
. .
.
Характеристики пациента
.
№ всего
.
Отрицательно,%
.
Не подлежит оценке,%
.
Положительно,%
.
п.
.
Возраст <.001
0–1 год 247 52,6 52,6 5 л 275 55,6 3.6 40,7
6-11 лет 296 50,0 1,7 48,3
12-17 лет 148 148 148
18 лет и старше 255 38,8 0,8 60,4
Диагностика
Лейкемия / лимфома 809 47,2 0,5 52,3
Генетический 304 52,6 52,6
43,8 1,1 55,1
Прочие 19 63.2 0,0 36,8
Этническая принадлежность * <0,001
Другое 525 42,1 5,3 52,6
Расположение центра трансплантации
США 965 51,4 4,0 44,6
За пределами США 256 37,9 4,325 9019 37,9 4,325 9019 902 902 902 902 трансплантация .01
1993-1999 784 51.4 4,5 44,1
2000-2004 437 43,5 3,4 53,1
Всего

9019 902 001 9019

.

.

Серология перед трансплантацией
.
. .
.
Характеристики пациента
.
№ всего
.
Отрицательно,%
.
Не подлежит оценке,%
.
Положительно,%
.
п.
.
Возраст <.001
0–1 год 247 52,6 52,6 5 лет 275 55,6 3,6 40,7
6-11 лет 296 50.0 1,7 48,3
12-17 лет 148 42,6 0,7 56,8
18 или старше
Диагноз <0,001
Лейкемия / лимфома 809 47.2 0,5 52,3
Генетический 304 52,6 14,8 32,6
MDS / SAA
Другое 19 63,2 0,0 36,8
Этническая принадлежность *
Белый 679 53,8 3,2 43,0
Прочие 525 42,1 5,3 .001
США 965 51.4 4,0 44,6
За пределами США 256 37,9 4,3 57,8
902 902 902 902 902 9025 9025 9025 9025 9025 9025 9025 9025 9025 0,01
1993-1999 784 51,4 4,5 44,1
2000-2004 437 43.5 3,4 53,1
Всего
1221
48,6
4,1
47,3

Таблица 2.

Многомерный анализ заболеваемости ЦМВ после трансплантации ХБ

9025 0-8,5) 2 за пределами США 9025 3,0 (1,3-6,9)

Характеристика
.


.

ОР (95% ДИ)
.

п.
.
Реципиент до трансплантации ЦМВ-антитела
Отрицательный 634 Справочный
<.001
Возраст получателя
0-1 лет 246 Ссылка
1,0 (0,7-1,5) ,9
12 лет и старше 392 1,2 (0,8-1,8) ,5
Этническая принадлежность получателя * 902 902
Белый 678 Артикул
Не белый 524 1.4 (1.06–1.9) .017
Расположение центра трансплантации
США 954 Справка 1,6 (1,2-2,1) .004
Год трансплантации
1993-1999 775 2000 427 1.5 (1,1–2,0) .004
Несоответствие HLA
0 67 .011
2-3 714 2,8 (1,2-6,3) 0,017
Материнские антитела к ЦМВ донора пуповинной крови
IgG 668 0.96 (0,7-1,3) ,8
IgM 42 1,4 (0,7-2,8) ,3
Эквивалент 7 0,8 (0,2-3,2) .
Отрицательный
485
Каталожный номер

9025 0-8,5) 2 за пределами США 9025 3,0 (1,3-6,9)

Характеристика
.


.

ОР (95% ДИ)
.

п.
.
Реципиент до трансплантации ЦМВ-антитела
Отрицательный 634 Справочный
<.001
Возраст получателя
0-1 лет 246 Ссылка
1,0 (0,7-1,5) ,9
12 лет и старше 392 1,2 (0,8-1,8) ,5
Этническая принадлежность получателя * 902 902
Белый 678 Артикул
Не белый 524 1.4 (1.06–1.9) .017
Расположение центра трансплантации
США 954 Справка 1,6 (1,2-2,1) .004
Год трансплантации
1993-1999 775 2000 427 1.5 (1,1–2,0) .004
Несоответствие HLA
0 67 .011
2-3 714 2,8 (1,2-6,3) 0,017
Материнские антитела к ЦМВ донора пуповинной крови
IgG 668 0.96 (0,7-1,3) ,8
IgM 42 1,4 (0,7-2,8) ,3
Эквивалент 7 0,8 (0,2-3,2) .
Отрицательный
485
Справочный

Рисунок 2.

Заболеваемость ЦМВ-инфекцией после трансплантации. Кумулятивная частота посттрансплантационной ЦМВ-инфекции у реципиентов, которые были отрицательными или неоцененными (А) или положительными по ЦМВ-антителам (В) до трансплантации: взаимосвязь со статусом материнских антител донора пуповинной крови к ЦМВ. Относительный риск (ОР) и значимость (Р) оценивались с помощью регрессии Кокса.

Рисунок 2.

Заболеваемость ЦМВ-инфекцией после трансплантации. Кумулятивная частота посттрансплантационной ЦМВ-инфекции у реципиентов, которые были отрицательными или неоцененными (А) или положительными по ЦМВ-антителам (В) до трансплантации: взаимосвязь со статусом материнских антител донора пуповинной крови к ЦМВ. Относительный риск (ОР) и значимость (Р) оценивались с помощью регрессии Кокса.

ЦМВ-инфекция после трансплантации была связана с тяжелой (3-4 степень) острой РТПХ (ОР = 1.7, 95% доверительный интервал [CI] = 1,3-2,2; P <0,001). Кроме того, среди пациентов, перенесших трансплантацию (n = 855), пациенты с посттрансплантационной ЦМВ-инфекцией (n = 194) имели более высокий риск вторичной несостоятельности трансплантата, чем пациенты без ЦМВ-инфекции (7,2% против 2,2%, соответственно; P = 0,002). Среди зарегистрированных ЦМВ-инфекций 63% проявились только при обнаружении вируса в крови. В целом, ЦМВ был зарегистрирован как причина или способствующая причина смерти у 6,3% из 693 реципиентов, которые умерли и имели зарегистрированную причину смерти (38 не сообщаются).

Тридцать три из 47 младенцев с положительным результатом посева слюны имели ПЦР-положительный CB с помощью внутренней ПЦР (случаи 1-33, Таблица 3), все подтверждены повторным тестированием (20, также протестированные с помощью ПЦР-анализа Roche, подтвердили положительный результат. ). ДНК ЦМВ обычно обнаруживалась как в плазме, так и в ДНК, полученной из лейкоцитов. Внутренняя ПЦР (включая вложенную ПЦР) дала отрицательный результат у 14 младенцев с положительным посевом (случаи 34-47; 9 случаев также были протестированы и оказались отрицательными с помощью анализа Roche).Один образец, который изначально был положительным только при анализе ПЦР в плазме, не мог быть повторно протестирован для подтверждения. Трое из младенцев с положительным посевом и отрицательным результатом ПЦР родились от матерей с отрицательными антителами к ЦМВ (случаи 35–37). У одного ребенка с отрицательным результатом ПЦР (случай 40) был однояйцевый близнец (одна плацента), у которого посев слюны и CB-PCR были отрицательными. Таким образом, всего 33 младенца были признаны имеющими врожденную ЦМВ-инфекцию, подтвержденную CB-ПЦР (0,12% младенцев, участвовавших в исследовании). ЦМВ-инфекция, подтвержденная ПЦР, была обнаружена у 22 из 11 649 младенцев в период обычного тестирования, матери которых были положительными по общему количеству антител (0.19%) и 7 из 184 младенцев, прошедших период обычного тестирования на антитела IgM, матери которых были положительными по IgM анти-CMV (3,8%, P <0,001). CB-ПЦР (включая вложенные) дала отрицательный результат как в лейкоцитах, так и в плазме у всех 94 контрольных младенцев с отрицательным посевом.

Таблица 3.

Младенцы с положительным посевом на ЦМВ: ПЦР пуповинной крови и материнские антитела против ЦМВ

902 90 199

9025 7-пол. 9025 9025 9025 P 1 60257 1 1 40 P D 902 902 902 902 902 902 902

9025 N 90 257 1: 160 9025 D 9025
N

.

ЦМВ-ПЦР пуповинной крови
.
. . .
.

Серология матери
.
.
. Внутренний PCR
.
. Roche PCR
.
. . Суммарные антитела против CMV . Общий титр антител к ЦМВ .
№ дела.
.
WBC
.
Плазма
.
WBC
.
Плазма
.
IgM
.

.

.
1 P P P P P P 1:80
2 P P P P P P P P P 1:20
3 P P P P P P 1: 160
P P N P 1: 160
5 P P P P N P 9025 1: 320 9019 9019 902 P P P N P 1: 160
7 P P P P P P 1:80
8 P P P P P P P P 1: 320
9 P P P P N P 1: 160
10 P P P P P P P 1: 160
11 P P P P N P 1:80
12 P P P P 1:40
13 P P P N P 1: 640
14 P P P N P 1 902
15 P P N P N P 1: 640
16 P P P P 1: 160
17 P N P P P P 1: 160
18 P 902 P 902 P N P 1:80
19 P P п. п. п. п. 1: 320
20 п. P P ND ND N P 1: 320
22 P P ND ND ND
23 P N ND ND N P 1: 160
24 P N 902 P P 902 P 1:40
25 P P ND ND N P 1: 320
26 P P N. P P ND ND N P 1:80
28 P P ND ND P P P
29 P N / P * ND ND P P 1:10
30 N N N P 1:40
31 P P ND , нет P ND ND P P 1:40
34 N N N P P P 35 N N N N N N 0
36 N N N N 902
37 N N ND ND N N 0
38 N N N N P P 1:20
39 N N N N N P 1:20
40 N N N N N P 1:40
N N N P 1:40
42 N N N N N 902 9019 902 43 N N N N N P
44 N N ND ND N P 1: 320
45 N N P 1:80
46 N N ND ND N P 1:80
ND
ND
N
P
1:20
902 90 199

9025 7-пол. 9025 9025 9025 P 1 60257 1 1 40 P D 902 902 902 902 902 902 902

9025 N 90 257 1: 160 9025 9025 9025 N 9025 9025
9020 N

.

ЦМВ-ПЦР пуповинной крови
.
. . .
.

Серология матери
.
.
. Внутренний PCR
.
. Roche PCR
.
. . Суммарные антитела против CMV . Общий титр антител к ЦМВ .
№ дела.
.
WBC
.
Плазма
.
WBC
.
Плазма
.
IgM
.

.

.
1 P P P P P P 1:80
2 P P P P P P P P P 1:20
3 P P P P P P 1: 160
P P N P 1: 160
5 P P P P N P 9025 1: 320 9019 9019 902 P P P N P 1: 160
7 P P P P P P 1:80
8 P P P P P P P P 1: 320
9 P P P P N P 1: 160
10 P P P P P P P 1: 160
11 P P P P N P 1:80
12 P P P P 1:40
13 P P P N P 1: 640
14 P P P N P 1 902
15 P P N P N P 1: 640
16 P P P P 1: 160
17 P N P P P P 1: 160
18 P 902 P 902 P N P 1:80
19 P P п. п. п. п. 1: 320
20 п. P P ND ND N P 1: 320
22 P P ND ND ND
23 P N ND ND N P 1: 160
24 P N 902 P P 902 P 1:40
25 P P ND ND N P 1: 320
26 P P N. P P ND ND N P 1:80
28 P P ND ND P P P
29 P N / P * ND ND P P 1:10
30 N N N P 1:40
31 P P ND , нет P ND ND P P 1:40
34 N N N P P P 35 N N N N N N 0
36 N N N N 902
37 N N ND ND N N 0
38 N N N N P P 1:20
39 N N N N N P 1:20
40 N N N N N P 1:40
N N N P 1:40
42 N N N N N 902 9019 902 43 N N N N N P
44 N N ND ND N P 1: 320
45 N N P 1:80
46 N N ND ND N P 1:80
ND
ND
N
P
1:20

Все матери 33 младенцев с подтвержденной ПЦР инфекцией ЦМВ были положительными по общему анти-ЦМВ, 79% — с высоким титром (≥ 1:80).Только 11 из них были положительными по IgM анти-ЦМВ. Среди контрольных матерей, напротив, 63 (67%) были анти-CMV-положительными ( P <0,001), только 30% имели высокие титры ( P <0,001) и только одна с IgM ( P ). <0,001). 14 матерей, у которых инфекция ЦМВ у младенцев не была подтверждена с помощью ПЦР, были аналогичны матерям контрольной группы по распространенности антител к ЦМВ, титру и распространенности анти-ЦМВ IgM. Все матери в этом исследовании были протестированы на ДНК ЦМВ с помощью собственного ПЦР-анализа.ДНК ЦМВ была обнаружена (только с помощью вложенной ПЦР) в ДНК, полученной из лейкоцитов от 6 матерей: у 5 был ребенок с подтвержденной ПЦР инфекцией ЦМВ, а шестой был положительным по культуре, но отрицательным с помощью CB-ПЦР.

Среди 184 матерей с IgM анти-CMV у 176 были младенцы с отрицательным посевом слюны, а среди 76 матерей с сомнительной реактивностью IgM все младенцы имели отрицательный посев. CB был протестирован на ДНК ЦМВ с помощью ПЦР в 246 из этих отрицательных по культуре случаев (170 из них 176 с IgM-положительной матерью и все 76 с сомнительным IgM) и 492 контрольных (246 от матерей с IgG, но без анти- IgM антител). CMV и 246 от матерей без обнаруженных антител).ДНК ЦМВ была обнаружена с помощью ПЦР в 5 образцах CB, 2 — с помощью собственной ПЦР и анализов Roche и 3 — только с помощью анализа Roche (все подтверждено повторным тестированием). Все 5 ПЦР-положительных образцов были взяты от новорожденных, рожденных от матерей с антителами IgM к ЦМВ, 4 — с высоким общим титром антител к ЦМВ (≥ 1:80). Если у этих ПЦР-положительных младенцев была врожденная ЦМВ-инфекция, несмотря на их отрицательный результат посева слюны, то у младенцев, рожденных от IgM-положительных матерей, действительно произошло до 13 инфекций, 7 из которых были обнаружены посевом и ПЦР, от 2 до 5 — только ПЦР (для всего 9-12 обнаружено с помощью ПЦР), и 1 — только с помощью культивирования.Если это так, то от 22% до 42% ПЦР-положительных инфекций среди младенцев от IgM-положительных матерей в этом исследовании были пропущены при посеве слюны.

Это первое исследование, в котором оценивалась связь между серологией доноров ХБ на антитела против ЦМВ и посттрансплантационной инфекцией ЦМВ у реципиента, а также оценивались альтернативные стратегии скрининга доноров ХБ на ЦМВ. Как и в предыдущих исследованиях реципиентов костного мозга (КМ) или ГСК периферической крови, инфекция ЦМВ была значительной причиной посттрансплантационной заболеваемости и смертности.У пациентов с ЦМВ-инфекцией, например, была повышенная частота вторичной недостаточности трансплантата, возможно, по крайней мере частично, из-за миелосупрессии, связанной с противовирусной терапией. 20,21 Также, как сообщалось в предыдущих исследованиях, ЦМВ-инфекция была тесно связана со статусом ЦМВ-антител перед трансплантацией реципиента. Этническая принадлежность реципиента и несоответствие HLA были независимо связаны с риском ЦМВ-инфекции после трансплантации, как и центр трансплантации и год трансплантации.Связь с несоответствием HLA может быть связана с более высокой частотой острой GVHD у реципиентов несоответствующих единиц CB. 10 Связь с годом трансплантации может отражать улучшенный диагноз с недавно внедренными анализами на основе ПЦР.

В отличие от исследований трансплантации костного мозга, посттрансплантационная ЦМВ-инфекция у реципиентов ХБ не имела обнаруженной связи с донорской серологией (т. Е. Статусом антител к ЦМВ у матери-донора). 22,23 Даже когда мать донора была положительной по IgM анти-ЦМВ (те, у которых был самый высокий риск рождения ЦМВ-инфицированного ребенка на основании посева слюны и CB-ПЦР), не было обнаружено связи с посттрансплантационным ЦМВ, хотя эта группа был относительно небольшим в нашем исследовании. Таким образом, серологические данные донорского материнского ЦМВ были плохим предиктором передачи ЦМВ реципиентам при трансплантации CB, поддерживая мнение о том, что единицы CB не нужно исключать для трансплантации на основании только серологических результатов донора по материнскому CMV.

Наше исследование выявило ожидаемую низкую частоту врожденной ЦМВ-инфекции у доноров ХБ (0,12% при положительном посеве слюны и подтвержденной CB-ПЦР), что находится на нижнем пределе ранее указанных значений. Низкая частота врожденной ЦМВ-инфекции может предсказывать более низкую общую частоту посттрансплантационной ЦМВ-инфекции у реципиентов ХБ, чем у реципиентов трансплантатов ВМ / периферической крови. Действительно, частота встречаемости у реципиентов без антител составляла всего 8% (предположительно, почти все были получены из какого-либо источника, кроме трансплантата CB).Заболеваемость среди реципиентов с положительной реакцией на ЦМВ (41%) также была ниже, чем сообщалось в некоторых предыдущих исследованиях реципиентов трансплантата BM. 1,20,23 Однако сравнение с историческими показателями должно проводиться с осторожностью из-за возможных различий в диагностических методах, профилактике ЦМВ или из-за того, что трансплантаты костного мозга были истощены Т-лимфоцитами. В недавнем исследовании, например, Chalandon и его коллеги 23 сообщили о высокой частоте посттрансплантационного CMV у CMV-антител-положительных реципиентов неманипулированных трансплантатов BM от анти-CMV-отрицательных доноров (81%).Напротив, частота встречаемости была только 33% у реципиентов истощенных Т-лимфоцитами трансплантатов от отрицательных доноров. Однако количество реципиентов в их исследовании было относительно небольшим, и они были отобраны из-за отсутствия серьезных посттрансплантационных осложнений. Тем не менее, их наблюдение неспособности передать ЦМВ-специфические Т-клетки памяти от этих доноров и, как следствие, трудности с установлением первичного иммунного ответа, необходимого для защиты пациента, поднимает вопрос о том, как функция Т-клеток при ХБ может повлиять на риск посттрансплантационной ЦМВ-инфекции. .На такие вопросы лучше всего ответят параллельные проспективные исследования со стандартизованными определениями случаев.

У большинства младенцев-доноров ХБ в этом исследовании, имевших положительный результат посева слюны, была подтверждена инфекция путем обнаружения ДНК ЦМВ в ХБ с помощью ПЦР. Однако некоторые предполагаемые инфекции не были подтверждены ПЦР, и наши данные предполагают, что у младенцев с положительным посевом с отрицательным ПЦР CB, скорее всего, был ложноположительный посев слюны.У одного такого младенца, например, был однояйцевый близнец, у которого был посев слюны и отрицательный результат CB-PCR. В 3 других случаях у матери не было обнаруживаемых анти-CMV. Более того, тот факт, что материнская серология (распространенность IgM и общий титр антител) для этой группы младенцев была аналогична таковой для контрольных животных с отрицательным посевом, подтверждает этот вывод. Ложноположительный посев слюны мог произойти при загрязнении образца слюны вагинальными выделениями матери или по более тривиальным причинам, таким как маркировка, технические или канцелярские ошибки. 24 Посев слюны также мог пропустить некоторые врожденные ЦМВ-инфекции. Среди младенцев с отрицательной культурой, которые предположительно относятся к группе высокого риска (мать с положительной реакцией на IgM анти-CMV), мы обнаружили от 2 до 5 возможных инфекций, обнаруженных с помощью ПЦР (в зависимости от анализа), и, как и младенцы с подтвержденными инфекциями, все, кроме одного имел высокий титр материнских антител. Ложноотрицательный посев может произойти по техническим причинам, таким как неадекватный сбор образцов, недавнее кормление ребенка, потеря жизнеспособности ЦМВ во время хранения или транспортировки, или по тривиальным причинам, таким как маркировка, технические или канцелярские ошибки. 25 Возможность дополнительных ложноотрицательных культур среди младенцев, матери которых были положительными по антителам, но отрицательными по IgM, не может быть исключена, даже если они не были обнаружены с помощью ПЦР, из любой контрольной группы из исследования 2. Даже если целых 40% врожденные инфекции были пропущены при посеве (как это могло произойти у младенцев с IgM-положительными матерями), прогнозируемая распространенность ложноотрицательных посевов у исследуемых младенцев, матери которых IgG-положительны, оценивается ниже 0.1%. Однако размер выборки из нашей группы контроля IgG-положительных / IgM-отрицательных был достаточен только для определения уровня положительности ПЦР 1,5% или выше с достоверностью 95%.

Положительная прогностическая ценность врожденных ЦМВ-инфекций, подтвержденная CB-ПЦР, составила 3,8% (7/184) для младенцев, рожденных от IgM-положительных матерей, что несколько ниже, чем показатель 8,3%, сообщенный Roback et al, 12 и только 0,2 %, когда мать была полностью положительной по анти-ЦМВ (независимо от статуса IgM).Эти данные согласуются с нашим наблюдением о том, что материнская общая и / или IgM-положительная реакция сами по себе также были плохими предикторами передачи ЦМВ от CB к реципиентам трансплантата. Таким образом, стратегия скрининга, основанная на положительности антител у матери донора, неоправданно исключает большое количество единиц CB, подавляющее большинство из которых не имеют риска передачи ЦМВ реципиентам. Важно отметить, что хотя у младенцев от матерей с положительным IgM-антителом к ​​ЦМВ встречаемость ЦМВ-инфекции выше, чем у младенцев от матерей с положительным IgG-антителом, наши данные показывают, что при скрининге только на анти-CMV материнские IgM можно пропустить две трети инфекций.Этот результат неудивителен, поскольку IgM является только временно положительным после острой инфекции CMV, и CMV также может передаваться от матери к младенцу, когда латентная инфекция реактивируется во время беременности, часто без продукции IgM анти-CMV. 10,26-28

Если тестирование доноров ХБ на наличие ЦМВ-инфекции остается обязательным для FDA, несмотря на его низкую распространенность у новорожденных и несмотря на то, что традиционные серологические методы скрининга не очень информативны при ХБ, потребуется практическая стратегия обнаружения вируса, которая требует учитывать специфичность и чувствительность, а также стоимость и логистику.Хотя посев ЦМВ слюны или мочи младенца считается «золотым стандартом» для выявления врожденной ЦМВ-инфекции, он требует сбора образца, отдельного от продукта CB, что увеличивает риск ошибок при сборе образцов, что является возможным объяснением причин. некоторые из ложноположительных и ложноотрицательных культур в нашем исследовании. Само тестирование трансплантата CB устраняет этот источник ошибки. Обнаружение ДНК ЦМВ в ХБ методами на основе нуклеиновых кислот, как показано в этом исследовании, может быть надежным, чувствительным и специфичным с тем преимуществом, что они используют ДНК, относительно стабильную молекулу, а не зависят от сбора образца, который точно получает и сохраняет жизнеспособный вирус.Кроме того, ПЦР может быть проведена ретроспективно на хранящихся образцах перед выпуском блока CB для трансплантации. Тот факт, что подтвержденные врожденные ЦМВ-инфекции были ограничены младенцами от матерей с положительными антителами, предполагает потенциальную стратегию скрининга, основанную на тестировании матерей на антитела к ЦМВ с последующим предварительным тестированием единиц CB на ДНК ЦМВ с помощью ПЦР, когда мать является положительной на антитела, независимо от ее статус IgM анти-CMV. В настоящее время любая стратегия выявления инфекции как таковой у донора ХБ, будь то посевы или анализы на основе ДНК, затруднена из-за отсутствия одобренного FDA анализа для скрининга доноров ХБ.

Ответ

на «Опыт пользователей пожилых онкологических больных с веб-инструментами медицинской информации: исследование« Думай вслух »»

Письмо

Мы с большим интересом читаем статью Болле и др., В которой подчеркиваются важные детерминанты удобства использования и воспринимаемой полезности интернет-информации о здоровье пожилых людей [1]. Этот документ своевременен и важен. Интернет-информация о здоровье все чаще рассматривается как эффективное средство обучения пациентов; однако потребностям пожилых людей в медицинской информации часто пренебрегают [2].Поэтому понимание того, как улучшить веб-инструменты для пожилых людей, было бы очень полезно.

Авторы приходят к выводу, что больные раком пожилого возраста могут использовать информационные веб-сайты по раку и находить их полезными. Тем не менее, есть определенные пояснения, которые кажутся необходимыми, прежде чем применять эти выводы в повседневной практике.

Во-первых, отметим, что участники были набраны из PanelCom, службы, которая набирает больных раком по электронной почте и проводит большинство исследований в режиме онлайн [3].Такие пациенты, вероятно, будут более опытны в работе с сетевыми технологиями, чем средний пожилой взрослый, и, следовательно, имеют более высокий порог для обнаружения проблем с удобством использования.

Во-вторых, при поиске медицинской информации пациенты, как правило, сначала используют общие запросы в поисковых системах, а не напрямую обращаются к конкретным медицинским веб-сайтам [4,5]. Следовательно, оценка авторами удобства использования этих веб-сайтов для навигации не совсем точно отражает истинную модель использования таких веб-сайтов.

Наконец, важно помнить, что веб-инструменты должны уравновешивать различные потребности отдельных групп пациентов. Например, увеличение размера текста также увеличивает потребность в прокрутке страницы — проблема, против которой возражали 9% участников. Следовательно, рекомендации, расширяющие возможности персонализации веб-инструментов, предпочтительнее общих рекомендаций.

Несмотря на эти соображения, очевидно, что такие факторы, как предоставляемый контент, удобочитаемость и использование мультимедиа, влияют на вероятность использования веб-информационных инструментов пожилыми людьми.Другие факторы, которые могут определять воспринимаемую полезность, также включают актуальность, авторство и предвзятость, содержащуюся в медицинской информации, все из которых могут быть потенциальными путями для будущих исследований. Кроме того, хотя авторы затрагивают важность межличностного общения с врачами вместе с веб-инструментами, истинная ценность интеграции этих инструментов в консультацию пациента также может быть исследована дополнительно. Специалисты здравоохранения имеют все возможности указать пациентам, использующим Интернет, в правильном направлении и помочь им найти соответствующие данные в условиях «информационной перегрузки».«Есть также данные, позволяющие предположить, что рекомендация врачом веб-инструментов увеличивает воспринимаемую полезность и соблюдение требований [6,7].

В свете этих выводов, по-прежнему существует потребность в качественной медицинской информации в Интернете, учитывающей потребности пожилых людей. Это исследование полезно для выяснения пути к разработке полезных информационных инструментов для такой группы пациентов.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2019 © Все права защищены.