Инфинити фото ку 70: Infiniti Q70 ( 70) — , , , : 26

Содержание

Обзор авто Infiniti Q70 — фото и видео, описание и характеристики автомобиля Инфинити Q70 2014 – н.в., I Рестайлинг в Москве от официальных дилеров

Infiniti Q70: классическая модель от японского автопроизводителя

Европейская презентация обновленной версии презентабельного седана была проведена на автосалоне в Париже в октябре 2014 года. Американцы же увидели модель немногим ранее, еще в апреле. По сравнению со своими предшественниками, автомобиль получил новую головную оптику, измененную радиаторную решетку и более хищный «прищур». А еще машина приобрела 18-дюймовые диски нового дизайна. Модернизированная система кругового обзора улучшила видимость в «мертвых» зонах, а в салоне стало тише благодаря доработанной шумоизоляции.

По технической части следует отметить, что на отечественном авторынке представлены две основные комплектации: Elite и Sport. Они оснащены бензиновыми двигателями на 2,5-3,7 литров мощностью 211-333 л. с. Автоматическая коробка передач сочетается с задним или полным приводом, что обеспечивает оптимальную устойчивость и маневренность в разных условиях.

Участие в каких программах предлагают дилеры при покупке Инфинити Q70?

В каталоге пользователь может выбрать не только модель или конфигурацию, но и лучшего продавца с выгодными расценками. Кроме этого, есть такие преимущества сотрудничества с проверенными автодилерами:

  • до 36 месяцев гарантийного обслуживания с возможностью замены основных комплектующих в ряде оговоренных случаев;
  • финансовая программа Infiniti Finance с кредитованием под 14% годовых;
  • пакет услуг «Помощь на дороге», который гарантирует мобильность авто и предоставляет помощь в случае поломки.

Autospot выступает не только честным посредником, но и дарит своим пользователям разнообразные бонусы, в том числе скидку до 12% на все вариации Q70 или сниженный прайс на сопроводительные услуги от партнеров.

Информация о модели Infiniti Q70 2014 – н.в., I Рестайлинг: технические характеристики, отзывы и фотографии авто. 3 и более обзоров на автомобиль Инфинити Ку 70 в кузове седан. Смотрите видео и фото, а также читайте отзывы о машине. Купить авто с пробегом в Москве на Autospot.ru!

Флагманский седан Infiniti Q70 отправлен в отставку — ДРАЙВ

В США у модели есть два варианта колёсной базы (2900 и 3051 мм), атмосферники V6 3.7 (334 л.с., 366 Н•м) и V8 5.6 (422 л.с., 561 Н•м), семиступенчатый «автомат», задний и полный привод. Цены начинаются с $50 400. Длиннобазный Q70L (на фото) доступен и в Китае, но с «четвёркой» 2.0 (211 л.с.).

Американский офис Infiniti подтвердил изданию Motor Authority, что в 2020 модельном году не нашлось места для седана Infiniti Q70. Дилеры распродают остатки, причём не без труда: за девять месяцев 2019-го реализовано лишь 2196 штук (-36,8%). Однако отношение к уходящему флагману в США уважительное, ведь тот был одним из немногих, кто пытался противостоять (пусть безуспешно) Большой немецкой тройке, то есть S-классу, седьмой серии и Audi A8. Вопрос о преемнике «семидесятки» пока остаётся открытым.

На облик следующего большого седана в прошлом году намекнул концепт Infiniti Q Inspiration, оснащённый чудо-мотором VC-Turbo. С тех пор много воды утекло: автор дизайна Карим Хабиб ушёл в KIA, а компания Infiniti покинула Западную Европу и поменяла президента. Альянс тоже уже не тот.

С одной стороны, спрос на седаны повсеместно падает из-за кроссоверного бума. С другой — место флагмана пусто не бывает. Если наследник у Infiniti Q70 всё же появится, он будет базироваться на новой архитектуре альянса, заточенной под электрификацию. (Первенцем платформы, видимо, станет паркетник Nissan Ariya.) Значит, следующая четырёхдверка окажется как минимум гибридной, если не сразу чисто электрической. Ждать её имеет смысл не раньше, чем через два-три года.

История Дмитрий Алексеев, Константин Болотов

Первый Infiniti М появился в 1990 году, был шестицилиндровым, выпускался только как купе и кабриолет и покинул конвейер в 1992-м вместе с японской моделью Nissan Leopard, на основе которой был сделан. Шасси — McPherson спереди и многорычажка сзади — отличалось оригинальными адаптивными стойками Nissan Sonar Suspension II, актуаторы которых получали команды от ультразвуковых датчиков, оценивавших качество полотна. К появившимся более десяти лет спустя седанам бизнес-класса этот автомобиль никакого отношения не имеет.

Заднеприводный седан Infiniti M (тип Y34) со стойками McPherson спереди тоже не назовёшь прямым предком нынешних седанов M/Q70. Производился он недолго — с 2003 по 2004 год, поскольку представлял собой американизированный Nissan Gloria/Cedric, выпускавшийся с 1997 года, а потому подлежавший скорому снятию с производства. От базового Ниссана Infiniti M отличался главным образом двигателем — модель для заокеанского рынка оснащалась 340-сильным мотором V8 4.5 серии VK.

Infiniti M второго поколения (тип Y50), построенный на платформе FM, был представлен публике в 2005 году. У него по традиции был Nissan-близнец для внутреннего японского рынка по имени Fuga. Здесь уже можно говорить о зарождении традиций: помимо модификаций М35 с V-образной «шестёркой» и M45 c «восьмёркой», появились спортивные версии M35 Sport и M45 Sport, а также полноприводная М35х. После рестайлинга 2007 года модель официально начала продаваться в России (с июля 2008 года).

Осенью 2009 года в свет вышел новый Infiniti M и с лета 2010 начал продаваться у нас. Российскому покупателю были доступны три модификации: M25, M37 и M56, два варианта привода (задний для M25 и M56, полный для M37 и M56), две спортивные версии (M37 S и M56 S). На других рынках можно было найти трёхлитровый турбодизель (с 2010 года) и гибридную версию (с 2011-го). В 2013-м в соответствии с новой политикой бренда линейка M была переименована в Q70 без привязки цифрового индекса к объёму двигателя. Помимо близняшки Фуги на конвейере в Точиги выпускается ещё и OEM-версия Mitsubishi Proudia, отличающаяся иным дизайном передней части и элементами отделки салона.

В 2014 году седан претерпел рестайлинг, не повлиявший на силовые агрегаты и салон. Изменились решётка, бамперы и светотехника, перешедшая на диоды. (Мы подробно рассказывали об этой реформе.) Одним из результатом стал запуск в США удлинённой версии Q70L (её колёсная база растянута на 151 мм, до 3051), ранее предлагавшейся только в Китае.

Infiniti Q70 (Инфинити Q70): цена, отзывы, фото

Общие сведения: Инфинити Q70 – самый большой седан японского производителя

Infiniti Q70 – крупный по размерам седан, ранее модель называлась «М». Автомобиль представлялся в 2014 году дважды в городах Нью-Йорк и Париж. Для европейского и американского рынка созданы отдельные версии, хотя внешне у них различия только в переднем бампере. В начале 2015 года в автомобиль внесли ряд изменений.

Автомобиль предназначен для тех, кто хочет проявить индивидуальность, а не приобрести большие седаны от общепризнанных лидеров класса. Конкурентами машины являются BMW 5-й серии и Mercedes E-Class.

В сравнение с предшествовавшей ему моделью М, Инфинити Q70 весьма заметно изменился. Автомобиль получил новые фонари, построенные на светодиодах, другой стала радиаторная решетка, спереди появилась иная оптика. Кроме того он обзавелся новыми литыми колесными дисками оригинального дизайна. Нужно сказать, что выглядит машина красиво и солидно, посмотрите фото Инфинити Q70.

Изменился и салон автомобиля. В нем появилось больше мест для размещения дорожных мелочей, увеличилось количество розеток на 12 вольт. Были внесены изменения в информационно-развлекательную систему. Получила ряд изменений и система кругового обзора. При выезде из переулков и дворов водитель заблаговременно получает информацию о наличии, создающих помехи транспортных средств и пешеходов. Кроме того была улучшена изоляция машины от шума и доработана подвеска автомобиля.

Главным техническим изменением можно признать появившийся в линейке моторов дизельный агрегат. Это мотор объемом 2,2 литра, мощность мотора 170 лошадиных сил, крутящий момент 400 Ньютонометров. Кроме того Инфинити Q70 купить можно с бензиновым мотором 3,7 литра мощностью 330 лошадиных сил, а также с гибридным мотором в основе которого лежит бензиновый двигатель объемом 3,5 литра. Над гибридной установкой специалисты поработали ради увеличения расстояния, которое машина может преодолеть на одном электричестве, кроме того в бензиновой части установки удалось снизить трение, что привело к некоторому снижению потребления топлива.

Нужно сказать, что технические характеристики Инфинити Q70 по потреблению топлива современным представлениям о том, сколько горючего должен потреблять автомобиль подобного класса соответствуют слабо. Замена трехлитрового дизельного двигателя в начале 2015 года мерседесовским мотором 2,2 литра, конечно, несколько улучшила положение, но даже на этом моторе при реальных испытаниях машина в нормы не вписывается. Тем не менее, именно этот двигатель является в линейке моторов наиболее экономичным.

Все комплектации автомобиля имеют довольно высокий уровень оборудования, а также привлекательный внешний вид, достойное качество сборки, высокие показатели и просторный интерьер. Но, несмотря на то, что Q70 является хорошим автомобилем на все случаи жизни, по большинству показателей автомобиль уступает своим соперникам, в том числе и по сторль немаловажному показателю, как экономичность.

Основные достоинства:

  • Щедрое оборудование;
  • Красивый внешний вид;
  • Экономичный дизельный мотор.

Относительные недостатки:

  • Дорого в покупке и эксплуатации;
  • Салон не столь роскошный как у соперников;
  • Автомобиль не является спортивным.

Изучаем автомобиль: Инфинити Q70 просторный, качественно оборудованный автомобиль

Двигатель, подвеска и трансмиссия: Эффективность двигателей оставляет желать лучшего

При прохождении виражей автомобиль демонстрирует хорошее сцепление с дорогой и хороший уровень стабилизации кузова, крен у машины небольшой. Однако это не та машина на которой можно попытаться получить спортивное наслаждение на извилистых пустынных загородных дорогах. Во всяком случае, до BMW 5-й серии, по спортивным качествам, машине далеко.

С точки зрения экономичности дизельный двигатель объемом 2,2 литра несомненно является лучшим выбором для Infiniti Q70, работает он гладко и не слишком громко, а также обеспечивает неплохой крутящий момент на средних оборотах. Однако показатель разгона до ста километров в час за 8,9 секунды, для этого класса машин, мягко говоря, является средненьким.

Бензиновый двигатель объемом 3,7 литра намного резвее. Он достигает скорости сто километров в час при старте с места за 6,2 секунды, что, конечно же, сильно облегчает обгоны на трассе. Однако показатели расхода горючего этим мотором очень высоки, и в наше время недешевого бензина эксплуатационные расходы на эту машину очень высоки. Так, что если Вы предпочитаете бензиновые двигатели, есть смысл попробовать гибридный вариант машины, правда, такая силовая установка сама по себе дороже.

Все модели Инфинити Q70 используют семиступенчатую автоматическую коробку передач, которая может чувствовать себя тяжеловесной, если Вы при динамичном разгоне рассчитываете на быстрое переключение скоростей.

Интерьер и комфорт: Салон машины комфортный тихий и изысканный

Infiniti Q70отдает приоритет комфорту, а не спорту. Подвеска машины отлично впитывает неровности дорог. Шум ветра и дороги в салоне сведены к минимуму. Правда колеса высших спецификаций диаметром 20 дюймов и низкопрофильной резиной на наших разбитых дорогах могут внести в салон машины некоторый дискомфорт.

Если Ваша машина оснащена дизелем, его звук, на низких оборотах, проникает в салон, не становясь, впрочем, никогда слишком громким и навязчивым. При крейсерских скоростях на автомагистралях, звук дизельного мотора становится почти незаметным.

Водительское кресло и рулевое управление предлагают достаточный набор регулировок, чтобы поиск комфортного положения за рулем не представлял существенной проблемы. Обзор в направлении назад ограничен из-за заднего стекла небольшого размера. Камера заднего вида в этой машине при парковке пригодится однозначно.

С

алон автомобиля достаточно просторен для того чтобы разместить с комфортом четырех взрослых человек. В обоих рядах сидений запас пространства для ног хороший, а достаточно высокая крыша оставляет и хороший запас пространства по высоте. Собственно в плане пространства проблема в салоне одна — это достаточно крупный трансмиссионный туннель, который ограничивает пространство для ног пятого пассажира, который займет место в середине заднего сидения. В длительных путешествиях это место можно считать относительно комфортным только для маленьких детей.

Багажник машины весьма приличный – 500 литров загрузочного пространства это хорошо, но у соперников и по этому параметру преимущество.

Уровень оборудования машины весьма приличный. Даже начального уровня Infiniti Q70 поставляется с системой отрывания салона без использования ключа, камерой заднего вида и двухзонным климат-контролем. Список оборудования, естественно, неполный. Топовая комплектация автомобиля добавит спортивную подвеску, полный привод и ряд других приятных и полезных «мелочей».

Выводы:

Infiniti Q70 –высококачественный седан очень непохожий на своих «одноклассников», если Вы хотите подчеркнуть свою индивидуальность к машине стоит присмотреться.

Специальное предложение

Приобрести новенький Infiniti Q70 по самой выгодной цене в Украине, вы можете обратившись к нам. Благодаря партнёрским отношениям с производителями и автосалонами, наши клиенты получают максимальные скидки и лучшие условия страхования. При этом автомобиль вы получите у официальных дилеров, что обеспечит все преимущества официального (а не «серого» или «черного») авто с полноценной гарантией и сервисным обслуживаниям.

VCP / p97 извлекает стерически захваченные кольца Ku70 / 80 из ДНК при репарации двухцепочечного разрыва

Резюме

Во время репарации двухцепочечного разрыва ДНК (DSB) кольцеобразный комплекс Ku70 / 80 оказывается захваченным на ДНК и требует активного воздействия извлекается, но остается неясным, что обеспечивает необходимую энергию.

Посредством восстановления репарации DSB на гранулах мы демонстрируем здесь, что заблокированные ДНК Ku-кольца высвобождаются с помощью AAA-ATPase, p97. Для достижения этого p97 требует гидролиза АТФ, взаимодействует с Ufd1-Npl4 ubiquitin адаптерным комплексом и специфически нацеливается на Ku80, который модифицируется с помощью K48-связанных цепей убиквитина.В клетках U2OS химическое ингибирование p97 или опосредованное siRNA истощение p97 или его адаптеров ухудшает удаление Ku80 после негомологичного концевого соединения DSB. Более того, он ослабляет ранние этапы гомологичной рекомбинации, согласующиеся с управляемым p97 высвобождением Ku, также влияя на выбор пути репарации.

Таким образом, наши данные решают центральный вопрос, касающийся регуляции Ku в репарации DSB, и иллюстрируют способность p97 сегрегировать даже прочно связанные белковые комплексы для высвобождения из ДНК.

Введение

Двухцепочечные разрывы ДНК (DSB) представляют собой наиболее разрушительный тип повреждения ДНК.Следовательно, клетки развили сложные механизмы репарации, которые включают скоординированную сборку и разборку комплексов репарационных белков (Ciccia & Elledge, 2010; Jackson & Bartek, 2009). Исходным сенсорным белком для DSBs является гетеродимер Ku70 / 80 (Ku) с центральной полостью, достаточно большой для размещения B-формы спирали ДНК (Walker et al., 2001). Его тороидальная форма не только обеспечивает высокое сродство к открытым концам (K d ~ 2 нМ; Blier et al., 1993) за счет протягивания ДНК через жесткий канал, но также обеспечивает избирательное связывание, поскольку интактная ДНК не может проникать в замкнутое кольцо.После связывания с ДНК Ku инициирует негомологичное соединение концов (NHEJ) путем привлечения дополнительных факторов NHEJ, включая DNA-PKcs, XLF, Artemis и ДНК лигазу IV (обзор в Lieber et al., 2010). Вместе с тем, связывание Ku с ДНК предотвращает обширную резекцию концов и тем самым ингибирует конкурирующий безошибочный путь гомологичной рекомбинации репарации (HRR) (Sun et al., 2012). Однако, поскольку каждая субъединица Ku полностью окружает ДНК (Walker et al., 2001), лигирование ДНК приводит к тому, что кольца Ku70 / 80 стерически блокируются с ДНК.Поскольку кольцо Ku не имеет защелки, это исключает раскрытие кольца для выхода из ДНК путем диссоциации дискретных субъединиц, как это видно для других ДНК-связывающих белков (например, PCNA). Следовательно, Ku необходимо активно извлекать с помощью структурного ремоделирования (Postow et al., 2008). Экстракция Ku запускается модификацией связанными с K48 цепями убиквитина и тремя различными лигазами E3, SCF Fbxl12 , RNF8 и RNF138, как было установлено, опосредуют убиквитинирование Ku80 (Postow & Funabiki, 2014; Feng & Chen, 2012; Ismail et al. ., 2015; Schmidt et al., 2015). Однако неясно, что обеспечивает необходимую энергию для извлечения Ku.

Валозин-содержащий белок (VCP) / p97 — это гексамерная АТФаза AAA + -типа, которая воздействует на убиквитинированные субстратные белки через убиквитиновые адаптерные белки. Он использует энергию гидролиза АТФ для отделения белков-субстратов от партнеров по связыванию или клеточных структур часто, но не всегда, для последующей деградации протеасомами (Jentsch & Rumpf, 2007). Хотя его роль наиболее изучена в деградации, связанной с ER (Stolz et al., 2011), было показано, что p97 извлекает различные убиквитинированные белки из хроматина в таких процессах, как регуляция клеточного цикла, реакции на транскрипционный и репликационный стресс, эксцизионная репарация или репликация нуклеотидов (обзор в Meyer et al., 2012; Dantuma et al., 2014) . Недавно было обнаружено, что p97 участвует в репарации DSB (Meerang et al., 2011; Acs et al., 2011) с одной функцией на поздней стадии HRR в контроле ассоциации комплекса Rad51-Rad52 (Bergink et al., 2013). Кроме того, p97 участвует в NHEJ, и нарушение функции p97 приводит к накоплению K48-связанных цепей убиквитина на сайтах DSB (Meerang et al., 2011). Однако до сих пор неясно, какова релевантная убиквитинированная мишень p97 и, следовательно, основной механизм, с помощью которого p97 вносит вклад в путь NHEJ, не выяснен.

В подходе масс-спектрометрии in vitro и мы идентифицируем Ku как основной субстрат p97 во время репарации DSB. Воспроизводя экстракцию Ku in vitro , мы демонстрируем, что p97 вместе с его кофактором Ufd1 извлекает Ku-кольца, которые улавливаются во время репарации ДНК, и показывают, что p97-опосредованное высвобождение Ku актуально в живых клетках.Более того, мы предоставляем доказательства, согласующиеся с опосредованной p97 экстракцией Ku, способствующей инициации HRR и, таким образом, способствуя выбору пути репарации.

Результаты

Ku70 / 80 накапливается на DSB

in vitro при нарушении p97

Чтобы повторить репарацию ДНК DSB in vitro , мы применили метод, использующий CSF (цитостатический фактор), арестованный экстракты яиц Xenopus laevis (Postow и др., 2008). Эти экстракты способны восстанавливать поврежденную ДНК посредством NHEJ, используя механизмы, очень похожие на механизмы, обнаруженные в клетках млекопитающих (Labhart, 1999; Di Virgilio & Gautier, 2005).Для выделения белков репарации ДНК из яичных экстрактов мы селективно биотинилировали фрагменты ДНК на одном конце (однократно биотинилированные, SB-ДНК) и соединили их со стрептавидиновыми шариками (рис. S1A). Как и ожидалось, свободные концы шариков SB-ДНК распознавались как DSB и легко восстанавливались экстрактом, что приводило к удвоению длины ДНК (рис. S1B). Напротив, дважды биотинилированные фрагменты ДНК (DB-ДНК) с обоими концами, прикрепленными к шарикам, не лигировали. Соответственно, Ku70 / 80 был обнаружен с гораздо более высоким содержанием на гранулах SB-ДНК (Рисунок S1C).В соответствии с эффективной репарацией ДНК мы идентифицировали основные факторы NHEJ и HRR на шариках SB-ДНК с помощью масс-спектрометрии, включая Ku70, Ku80, DNA-PKcs, XLF, Mre11, Rad50 и ортолог Xenopus Nbs1, Nbn1. (Таблица S1).

Для беспристрастного подхода к выявлению соответствующей мишени p97 в репарации DSB мы применили безметочную количественную масс-спектрометрию (LFQ-MS) для идентификации тех белков, которые специфически накапливались на гранулах SB-ДНК, когда активность p97 была нарушена.Чтобы ингибировать p97, мы использовали укорочение p97-ND1, которое является доминантно-отрицательным, потому что оно лишено второго, наиболее активного ATPase домена, D2, и, следовательно, улавливает убиквитинированные субстратные белки (Ye et al., 2003). Наряду с эндогенным p97 Xenopus на шариках SB-ДНК, мы обнаружили компоненты NHEJ Ku70 / 80 и регуляторную киназу DNA-PKcs среди обогащенных белков в присутствии p97-ND1 (и таблица S2). Напротив, компоненты конкурирующего MRN-комплекса, инициирующего HRR, Rad50, Mre11 и Nbn1 / Nbs1 были менее многочисленными, хотя последние два были ниже применяемого порога.

p97 требуется для освобождения Ku80 из DSB в экстрактах яиц Xenopus

Ku70 / 80 накапливается на DSB, когда p97 скомпрометирован. Восстановление DSB воссоздали в экстракте Xenopus яичного CSF с линейной ДНК, иммобилизованной на одном конце на гранулах стрептавидина (гранулы SB-ДНК), так что свободные концы были лигированы (см. Фигуру S1A). Гранулы инкубировали с доминантно-отрицательным мутантом p97-ND1 (8 мкМ гексамер) или без него в течение 45 мин и связанные белки сравнивали с помощью безметочной количественной масс-спектрометрии.Белки выше порога частоты ложного обнаружения 5% (черная линия) считались значительно обогащенными (положительные значения x; темные кружки) или уменьшенными (отрицательные значения x; белые кружки = комплекс MRN) при добавлении p97-ND1.

B Экспериментальная схема анализа высвобождения Ku80. Гранулы SB-ДНК сначала инкубировали в яичном экстракте с добавлением 35 S-меченного Ku80 и p97-ND1 (8 мкМ). Через 30 мин (t 0 ) Ku80 с открытых концов удаляли промывкой солью, и шарики переносили в свежий экстракт без 35 S-Ku80, но с добавлением только буфера, 8 мкМ p97-ND1 (ND1), или неактивный p97-ND1, несущий супрессорную мутацию K251A (ND1 KA ).В указанное время отбирали образцы супернатанта и шариков и анализировали с помощью гелей SDS и авторадиографии.

C Авторадиография Ku80 на шариках SB-ДНК из анализа в B.

D Количественное определение C. Ku80, оставшегося на шариках, нормализовали до t 0 .

E Количественное определение C. Общее количество убиквитинированного Ku80 было нормализовано до t 0 .

F Авторадиография супернатантов из анализа высвобождения Ku80.

G Количественная оценка выделенного F. Ku80 был нормализован до t 30 контроля.

H Авторадиография гранул SB-ДНК из 35 Анализ высвобождения S-Ku80 после обработки ингибитором p97 NMS-873 (20 мкМ) или только ДМСО.

I Количественное определение H. Ku80, остающегося на шариках, было нормализовано до t 0 .

J Количественное определение H. Общее количество полиубиквитинированного Ku80 было нормализовано до t 0 .

K Авторадиография супернатантов из анализа высвобождения Ku80, как в H.

L Количественное определение высвобожденного K. Ku80 нормализовали до t 30 контроля.

Планки погрешностей во всех количественных оценках обозначают SD (n = 3). * р <0,05; ** p <0,01; *** р <0,001. См. Также рисунок S1, таблицы S1 и S2.

Кроме того, мы наблюдали обогащение белков адаптера убиквитина p97 Ufd1, Npl4 и FAF1, предполагая, что они были захвачены конъюгатами убиквитина, стабилизированного p97-ND1.

p97 необходим для экстракции Ku из DSB в экстрактах яиц

Xenopus

Учитывая, что ранее было показано, что Ku высвобождается из хроматина убиквитин-зависимым образом (Postow et al., 2008; Ismail et al., 2015) , мы предположили, что p97 может извлекать Ku из ДНК. Чтобы проследить экстракцию Ku количественным образом, мы сначала загрузили in vitro, синтезировал 35 S-радиоактивно меченный Ku80 на шарики SB-ДНК в яичном экстракте. Впоследствии мы применили промывку с высоким содержанием соли, которая, как было ранее показано, удаляет все комплексы Ku, которые не захватываются стерически на ДНК (Paillard & Strauss, 1991), и которая также диссоциирует не захваченные белки из гранул ДНК в этом анализе (рисунок S1D). .Затем мы наблюдали за высвобождением оставшегося Ku80 в экстракте, в котором отсутствовала радиоактивная метка Ku80, как было установлено ранее (; Postow et al., 2008).

Меченый радиоактивным изотопом Ku80 был обнаружен на шариках как отдельная полоса в дополнение к видам с более высокой молекулярной массой, которые указывали на полиубиквитинирование Ku80 (). В течение 60 минут Ku80 высвобождался из гранул (), и немодифицированный Ku80 появлялся в супернатанте в виде отдельной полосы при 90 кДа (), демонстрируя, что Ku80 эффективно экстрагировался из гранул и предполагал, что впоследствии он был деубиквитинирован.Мы использовали два подхода, чтобы продемонстрировать потребность в p97 для извлечения Ku80. Во-первых, добавление доминантно-отрицательного варианта p97-ND1 значительно задерживало экстракцию Ku80 и приводило к сохранению убиквитинированной формы (). Соответственно, высвобождение в супернатант подавлялось (). Этот эффект был специфическим, поскольку такая же концентрация контрольного варианта p97-ND1, p97-ND1-KA влияла на экстракцию Ku80 и высвобождение в супернатант в меньшей степени. p97-ND1-KA содержит супрессорную мутацию K251A, что делает его недостаточным для связывания с субстратом и, следовательно, менее ингибирующим (Ye et al., 2003).

В качестве независимого подхода для подтверждения потребности в p97 мы применили аллостерический ингибитор АТФазы p97 NMS-873 (Magnaghi et al., 2013). Ингибитор значительно задерживал экстракцию Ku80 из гранул ДНК, сравнимый с эффектом добавления p97-ND1 (), и снова приводил к накоплению убиквитинированного Ku80 (). Соответственно, он также ингибировал высвобождение Ku80 в супернатанте (). Экстракция Ku80 является предпосылкой для последующей деградации протеасомой, которую можно наблюдать в экстракте при добавлении большего количества свободной линейной ДНК (Postow et al., 2008). Мы подтвердили ДНК-индуцированную деградацию Ku80 при добавлении ДНК и обнаружили, что деградация Ku80 блокируется, когда p97 ингибируется NMS-873 (Фигуры S1E и S1F), как и ожидалось, если p97 требуется для экстракции Ku. Таким образом, эти данные демонстрируют, что p97 и его АТФазная активность необходимы для экстракции Ku80 из ДНК в DSB in vitro .

p97 нацелена на Ku80, модифицированный K48-связанными цепями убиквитина на гранулах ДНК

Затем мы спросили, является ли роль p97 в экстракции Ku прямой, и поэтому исследовали рекрутирование p97 на гранулы ДНК в экстракте яиц с помощью вестерн-блоттинга.Эндогенный или добавленный p97 дикого типа не был обнаружен на гранулах, что согласуется с временным взаимодействием p97 с его субстратами (). Однако, когда мы дополнили экстракт ATPase-дефицитным мутантом p97, улавливающим субстрат, в данном случае полноразмерным p97-EQ (мутация E578Q в домене D2 ATPase; Ye et al., 2003), p97 был легко обнаружен на бусины (). Чтобы выяснить, зависит ли рекрутирование p97 на гранулы ДНК конкретно от Ku80, мы иммуно-истощили Ku80 из экстракта перед добавлением гранул ДНК.Следует отметить, что истощение Ku80 совместно истощает Ku70, а также устраняет рекрутирование p97-EQ (), указывая тем самым, что p97 локализуется в сайтах DSBs главным образом посредством связывания с Ku.

p97 нацелен на Ku80, модифицированный K48-связанными цепями убиквитина на шариках DSB

A Взаимодействие p97 с шариками SB-ДНК (SBB) регулируется АТФазой и зависит от Ku80. Гранулы SB-ДНК инкубировали в экстракте, который был ложно-истощенным или иммуно-истощенным по Ku80, и с добавлением только буфера p97-дикого типа (вес; 0.33 мкМ) или такую ​​же концентрацию улавливающего субстрат мутанта p97 E578Q (EQ), как указано, в течение 30 мин. Гранулы извлекали (PD SBB) и связанные белки анализировали вестерн-блоттингом с указанными антителами. xKid был исследован как средство восстановления.

B Экстракты, содержащие p97 EQ (0,33 мкМ), дополняли линейной ДНК или только буфером и инкубировали в присутствии 0,75 мг / мл убиквитина (вес.) Или убиквитина с K48R, K63R, K11R или K0 ( все лизины, мутировавшие в аргинины), как указано, за 30 мин до иммунопреципитации (IP) с Ku80 или контрольными антителами, как указано.Интенсивность сигналов определяли количественно и нормализовали относительно контроля дикого типа.

C Экстракты дополняли линейной ДНК и p97-ND1 или p97-ND1 KA (8 мкМ), как указано, и инкубировали в течение 1 ч перед иммунопреципитацией (IP). Вестерн-блот, как указано. Интенсивность сигналов определяли количественно и нормализовали для контроля.

D SB-ДНК-гранулы инкубировали в яичном экстракте с добавлением буфера (SBB) или 0,33 мкМ p97 E578Q (SBB + p97 EQ ) в течение 30 минут и связанные белки анализировали с помощью иммуноблоттинга.

E Анализ высвобождения Ku80, как в экстрактах, которые были ложно-обедненными (Δmock), обедненными Ufd1 (ΔUfd1) или Ufd1-истощенными и дополненными 2 мкМ рекомбинантным комплексом Ufd1-Npl4 (ΔUfd1 + Ufd1-Npl4).

F Количественная оценка E. Удерживаемый Ku80 на шариках SB был количественно определен и нормализован до t 0 .

G Авторадиография супернатанта из анализа высвобождения гранул, как в E.

H Количественное определение G. Высвобожденный Ku80 был нормализован до t 30 контроля.

Все полосы ошибок обозначают стандартную погрешность трех независимых экспериментов. * р <0,05; ** p <0,01; *** р <0,001. См. Также рисунок S2.

Ранее было показано, что высвобождение Ku из ДНК запускается модификацией Ku80, специфически связанной с K48-связанными цепями убиквитина (Postow et al., 2008; Feng & Chen, 2012), и мы подтвердили повышенные уровни K48-связанного убиквитинирования. на гранулах SB-ДНК по сравнению с гранулами DB-ДНК (Рисунок S1C). Чтобы проверить, является ли эта модификация критической для нацеливания p97 на Ku, мы добавили вариант убиквитина с мутацией K48R, которая блокирует удлинение цепей K48, и иммунопреципитировали Ku80.Несмотря на присутствие эндогенного убиквитина дикого типа, добавление рекомбинантного убиквитина-K48R сдвинуло модификацию Ku80 к профилю с более короткими цепями по сравнению с контролем с рекомбинантным убиквитином дикого типа (), подтверждая предыдущие результаты (Postow et al., 2008). Примечательно, что убиквитин-K48R, но не убиквитин дикого типа, снижает рекрутирование p97 в комплекс Ku (), показывая, что p97 нацелен на K48-модифицированный Ku80 на ДНК. Влияние K48R на убиквитинирование и связывание p97 было столь же сильным, как и для варианта убиквитина K0, в котором отсутствуют все лизины, но не наблюдалось для мутантов убиквитина K63R и K11R, подтверждая, что K48-связанные цепи убиквитина являются соответствующими видами цепей для этого процесса. .Напротив, инактивация p97 с помощью p97-ND1 () или NMS-873 (фигура S2A) приводила к специфическому накоплению цепей K48, но не цепей K63. Как и ожидалось, этого накопления не наблюдалось в присутствии контроля p97-ND1-KA (). Эти данные предоставляют прямые биохимические доказательства того, что p97 нацелен и извлекает Ku80, который модифицирован цепями убиквитина, связанными с K48.

p97 взаимодействует с адаптером убиквитина Ufd1-Npl4 для экстракции Ku

p97-опосредованная экстракция обычно требует адаптеров убиквитина для облегчения связывания и процессинга субстрата (Stolz et al., 2011). Мы предположили, что в этом участвует главный адаптер Ufd1, потому что он необходим для ряда p97-опосредованных функций на хроматине и накапливается на SB-ДНК-шариках в нашем подходе масс-спектрометрии вместе со своим партнером по связыванию Npl4 (). Сначала мы подтвердили с помощью вестерн-блоттинга обогащение Ufd1 и Npl4 на гранулах SB-ДНК яичным экстрактом с добавлением p97-EQ по сравнению с контрольным буфером (). Напротив, альтернативный кофактор p97, p47, не был задействован ни в одном из условий. Мы истощили Ufd1 из яичных экстрактов с помощью Ufd1-специфических антител.Как и ожидалось, это привело к частичному кодированию Npl4, но не p47 или p97 (Рисунок S2B). Следует отметить, что истощение Ufd1-Npl4 уменьшало связывание p97 с Ku80 в экспериментах по коиммунопреципитации (фигура S2C), предполагая, что Ufd1-Npl4 функционирует как адаптер субстрата для убиквитинированного Ku80. Важно отметить, что истощение Ufd1-Npl4 снижает скорость извлечения Ku80 из шариков SB-ДНК (), и это восстанавливается путем повторного добавления очищенного комплекса Ufd1-Npl4 (). Эти данные показывают, что p97 должен взаимодействовать с адаптерами убиквитина, включая главный кофактор Ufd1 при экстракции Ku80 из DSB ДНК.

p97 необходим для экстракции Ku80 во время репарации DSB в клетках U2OS

Чтобы дополнительно подтвердить, что p97-опосредованная экстракция Ku актуальна в живых клетках, мы контролировали динамику фокусов Ku80 в DSB с помощью микроскопии сверхвысокого разрешения с использованием метода предварительной экстракции. для удаления Ku80, не связанного с хроматином, перед фиксацией клеток (Britton et al., 2013). Как и ожидалось, ионизирующее излучение (ИК; 10 Гр) вызвало образование фокусов Ku80, которые в значительной степени разрешились в течение 60 минут (). Напротив, в клетках, обработанных ингибитором p97 NMS-873, фокусы Ku80 сохранялись через 60 мин.Для количественной оценки большего количества образцов мы проанализировали высвобождение Ku путем определения общей интенсивности сигнала Ku80 с помощью традиционной конфокальной микроскопии. В соответствии с нашим подходом сверхвысокого разрешения Ku80 сохранялся на хроматине при ингибировании p97 даже через 2 часа после облучения ().

p97 опосредует высвобождение Ku из хроматина в клетках U2OS

A Ku80 foci assay. Клетки U2OS облучали 10 Гр или имитировали обработку (0 Гр), оставляли для восстановления в присутствии NMS-873 (10 мкМ) или ДМСО и фиксировали в указанные моменты времени.Клетки предварительно экстрагировали буфером, содержащим РНКазу (CSK + R), фиксировали и Ku80 визуализировали с помощью иммунофлуоресценции и микроскопии сверхвысокого разрешения 3D-SIM.

B Автоматическая количественная оценка изображения A (среднее значение 5 ячеек на условие).

C Клетки U2OS обрабатывали, как в А, с NMS-873 или без него, а Ku80 визуализировали с помощью традиционной конфокальной микроскопии.

D Средняя интенсивность сигнала Ku80 в ядре была количественно определена с помощью автоматического анализа изображений и нормирована на t 5 .Серая область указывает время облучения.

E Клетки U2OS обрабатывали указанной миРНК, нацеленной на p97, Ufd1 или контроль (sictrl) в течение 48 часов. См. Рисунок S4 для получения информации об эффективности истощения и дополнительных миРНК. Клетки облучали 10 Гр или имитировали обработку (0 Гр), фиксировали в указанные моменты времени, и связанный с хроматином Ku80 визуализировали, как в C.

F Автоматическая количественная оценка изображений E. с siRNA, нацеленной на Ufd1, FAF1 или контроль (sictrl) в указанных комбинациях и обрабатываемых, как в E.

H Автоматическая количественная оценка G на изображении, как в F.

I Количественная оценка гель-электрофореза в импульсном поле. Клетки U2OS облучали (10 Гр) и обрабатывали NMS-873 (10 мкМ), NU7441 (ингибитор ДНК-PKcs; 5 мкМ) или только ДМСО. Количество разорванной ДНК в каждом образце сравнивали с эталонным набором образцов, облученных разными дозами (эквивалент дозы, Deq). NU7441 служил положительным контролем для ингибирования NHEJ.

J Считывание репортерного анализа репортерной репарации гомологичной рекомбинации (HRR) DR-GFP с указанными миРНК.siRad51 служил положительным контролем. Флуоресценцию GFP измеряли с помощью проточной цитометрии.

Среднее ± стандартное отклонение; n = 3 с ≥ 50 ячейками на условие; ** p <0,01; *** р <0,001. Все масштабные линейки: 10 мкм. См. Также рисунок S3.

Чтобы подтвердить этот результат, мы выполнили опосредованное siRNA истощение p97 или его адаптеров (эффективность истощения см. На рисунках S4B – S4F). Истощение p97 или Ufd1 различными миРНК значительно снижало удаление Ku80 в более поздние моменты времени по сравнению с истощенными в контроле клетками (, S3A и S3B).Это было подтверждено установкой истощения / восстановления Ufd1 (Рисунки S3C и S3D).

Истощение партнера Ufd1 Npl4 также влияет на удаление Ku80, хотя и в меньшей степени (рисунки S3E и S3F), что позволяет предположить, что Npl4 менее критичен, чем Ufd1 для процесса, что также наблюдалось для других субстратов p97 ранее (Riemer et al. , 2014; Raman et al., 2011). Истощение p97-адаптера FAF1, который также накапливается на SB-ДНК-бусинах in vitro (), оказывало лишь умеренный эффект при его отсутствии (Фигуры S3E и S3F).Интересно, однако, что совместное завершение Ufd1 и FAF1 более сильно снижает экстракцию Ku80, чем истощение только Ufd1 (), указывая тем самым, что Ufd1 и FAF1 могут частично избыточно функционировать как адаптеры убиквитина в этом процессе. Истощение адаптера p97 UBXD7, которое не было обнаружено на шариках SB-ДНК, не имело эффекта (Фигуры S3E и S3F).

Эксперименты на клетках до сих пор формально не продемонстрировали, что персистирующий Ku, наблюдаемый при ингибировании p97, улавливается репарированными DSB, а не связывается с нерепарированными открытыми концами ДНК.Фактически, мы наблюдали стойкое фосфорилирование h3AX после обработки NMS-873 (рис. S3G), что указывает на продолжающуюся передачу сигналов повреждения ДНК. Поэтому мы применили гель-электрофорез в импульсном поле (PFGE), чтобы контролировать степень репарации ДНК в отсутствие или в присутствии NMS-873. Это показало, что ДНК эффективно восстанавливалась даже в присутствии ингибитора p97 через 2 часа после облучения (), когда Ku80 все еще сохранялся (). Это демонстрирует, что в отсутствие активности p97 большая часть Ku сохраняется на повторно соединенной ДНК, и что сохранение Ku при ингибировании p97 не является следствием неспособности репарации ДНК.В то время как на репарацию NHEJ не влияло ингибирование p97, HRR, наблюдаемая в репортерном анализе, снижалась из-за истощения p97 или Ufd1 (), что согласуется с предыдущими результатами (Meerang et al., 2011; Bergink et al., 2013). Вместе эти данные подтверждают представление о том, что p97 извлекает большую часть Ku из клеток после репарации ДНК с помощью NHEJ и, и что он также участвует в HRR.

Ингибирование p97 ослабляет HRR-ассоциированное фосфорилирование RPA

Недавно было показано, что фракция Ku также может быть извлечена из концов ДНК до репарации DSB, и что это запускается убиквитинлигазой RNF138 в качестве элемента выбора пути репарации. в пользу безошибочного HRR перед NHEJ (Ismail et al., 2015; Schmidt et al., 2015). Мы индуцировали DSB, специфичные для S-фазы, используя камптотецин, ингибитор топоизомеразы I, в клетках U2OS и отслеживали DSB-зависимое фосфорилирование оцДНК-связывающего белка RPA32 по Ser4 / 8 в качестве раннего маркера активности HRR. Конфокальная микроскопия показала, что ингибирование p97 NMS-873 в значительной степени снижает образование очагов фосфо-RPA, что указывает на ослабление HRR (). Это отражалось в снижении общих уровней фосфорилирования RPA, вызванного повреждением, после обработки NMS-873, что было обнаружено с помощью вестерн-блоттинга ().Как и ожидалось (Ismail et al., 2015), ингибитор протеасом MG132 оказывал лишь слабый эффект в этих условиях, тогда как Pyr-41, ингибитор фермента, активирующего убиквитин E1, отменял фосфорилирование RPA (2). Чтобы подтвердить этот эффект, мы использовали РНКи. Как и ожидалось, истощение RNF138 снижает фосфорилирование RPA (). Примечательно, что также истощение p97, Ufd1 или Npl4, но не альтернативного цитоплазматического адаптера UBXD1 в качестве контроля, снижало фосфорилирование RPA (и S4A). Соответственно, истощение p97 двумя миРНК или химическое ингибирование p97 NMS-873 также снижает последующее образование очагов Rad51 после облучения (), в соответствии с предыдущими сообщениями (Meerang et al., 2011; Бергинк и др., 2013). Это открытие предполагает, что p97 способствует приверженности HRR и согласуется с ролью в извлечении Ku также из открытых концов ДНК во время выбора пути репарации ДНК.

Ингибирование p97 ослабляет раннюю стадию репарации гомологичной рекомбинации.

A Ингибирование p97 снижает образование очагов фосфо-RPA. Клетки U2OS обрабатывали DMSO или NMS-873 (5 мкМ) кратковременно до и во время обработки 1 мкМ камптотецином (+ CPT) в течение 60 минут для индукции DSB или DMSO (-CPT) в качестве контроля.Фосфо-RPA (Ser4 / 8) визуализировали с помощью иммуноокрашивания и конфокальной микроскопии.

B Автоматическая количественная оценка изображений в A. Среднее значение (n = 2), столбцы ошибок обозначают диапазон значений (n = 2, по крайней мере, 100 ячеек на условие).

C Иммуноблот-анализ фосфорилирования RPA (Ser4 / 8) через 60 мин после индукции DSB, как в A, на клеточных лизатах из клеток U2OS, обработанных указанными ингибиторами (MG132: ингибитор протеасом, 20 мкМ; Pyr-41: убиквитинлигаза E1 ингибитор, 50 мкМ).Обнаружение циклина A (CycA) для подтверждения развития клеточного цикла до S / G 2 .

D Иммуноблот-анализ клеток, обработанных, как в пункте C, после опосредованного siRNA истощения указанных белков.

E Клетки U2OS трансфицировали siRNA, нацеленной на p97 или контроль (sictrl), или обрабатывали ДМСО или 5 мкМ NMS-873 и облучали 2 Гр или ложно обработанными (0 Гр). Клетки оставляли для восстановления в присутствии миРНК или ингибитора и фиксировали через 8 ч после облучения.Rad51 визуализировали с помощью конфокальной микроскопии.

F Среднее количество фокусов Rad51 на ядро ​​было количественно определено с помощью автоматического анализа изображений. Среднее ± стандартное отклонение; n = 3, по крайней мере, с 50 клетками на условие и эксперимент.

G Модель функции p97 при выделении Ku80 из ДНК после DSB. При связывании с поврежденной ДНК Ku инициирует NHEJ (слева) и одновременно предотвращает резекцию конца, чтобы ингибировать HRR. После завершения NHEJ Ku топологически захватывается лигированной ДНК.Он убиквитинируется, а затем экстрагируется p97. Как элемент переключения пути репарации, фракция Ku также может быть убиквитинирована и нацелена p97 на открытые концы ДНК, чтобы сделать возможным резекцию конца и HRR (правая сторона).

* р <0,05; ** р <0,01. Все масштабные линейки: 10 мкм. См. Также рисунок S4.

Обсуждение

Применяя комбинацию подходов in vitro и in vivo в этом исследовании, мы собрали недвусмысленные доказательства того, что убиквитин-направленная AAA + -ATPase p97 обеспечивает необходимую движущую силу для извлечения ключевого регулятора Ремонт DSB, Ku, из ДНК.В прошлом был идентифицирован ряд белков, которые экстрагируются из хроматина с помощью p97 в различных процессах (обзор Meyer et al., 2012, Dantuma et al., 2014). Однако комплекс Ku70 / 80 выделяется среди этих факторов, потому что он образует прочно связанное кольцо, которое стерически захватывается ДНК после лигирования DSBs (Walker et al., 2001). Даже на открытых концах ДНК Ku плотно заблокирован на ДНК из-за своего ориентированного и, следовательно, однонаправленного режима связывания (Krishna & Aravind, 2010). В результате необходимы энергетически обусловленные конформационные изменения, чтобы открыть кольцо и высвободить Ku из ДНК (см. Модель).

Было показано, что три убиквитинлигазы, SCF Fbxl12 , RNF8 и RNF138 убиквитинируют Ku80 в различных условиях, которые, вероятно, представляют собой альтернативные пути запуска экстракции (Postow & Funabiki, 2014; Feng & Chen, 2012; Ismail et al., 2015; Schmidt et al., 2015). Это согласуется с наблюдением, что p97 способен взаимодействовать с различными лигазами (Alexandru et al., 2008) и напоминает ER-ассоциированную деградацию, когда альтернативные пути убиквитинирования сходятся на p97, чтобы опосредовать экстракцию субстрата из мембраны (Stolz et al. al., 2011). Наши данные о in vitro также подтверждают мнение о том, что экстракция Ku80 запускается специфически цепями убиквитина, которые связаны через K48. Это согласуется с более ранними результатами, показывающими роль цепей K48, конъюгированных с Ku, по крайней мере для двух лигаз, SCF Fbxl12 в экстрактах яиц Xenopus и RNF8 в культивируемых клетках (Postow et al., 2008; Postow & Funabiki, 2014 ; Feng & Chen, 2012), а также подчеркивает роль связанных с K48 цепей убиквитина в ответах на повреждение ДНК (Bekker-Jensen & Mailand, 2011; Jackson & Durocher, 2013).Последовательно мы показываем, что p97 взаимодействует с адаптерами убиквитина во время экстракции Ku. Мы обнаружили, что p97 нуждается в основном адаптере Ufd1, который также функционирует в др. P97-обеспечиваемых процессах (Stolz et al., 2011). Более того, он включает частично избыточным образом адаптер FAF1 ubiquitin, который, что касается связанных с хроматином функций p97, до сих пор был связан только с репликацией (Franz et al., 2016).

В то время как мы показываем, что p97 извлекает солеустойчивую фракцию Ku80, которая стерически захватывается после репарации ДНК, мы представляем дополнительные доказательства, согласующиеся с ролью p97 в удалении части Ku перед лигированием с нерепарированных концов ДНК и тем самым влияя на выбор пути репарации для отдавайте предпочтение безошибочному HRR, а не склонному к ошибкам NHEJ (см. модель).Однако фактическая репарация путем NHEJ не нарушается ингибированием p97. Это отражает эффект истощения убиквитинлигазы RNF138, которая ранее участвовала в выборе пути репарации за счет убиквитинирования Ku и запуска его экстракции перед репарацией (Ismail et al., 2015; Schmidt et al., 2015). Это указывает на то, что p97 не только высвобождает Ku после репарации DSB, но, наряду с RNF138, также вносит вклад в ключевой процесс принятия решений при инициации репарации и тем самым влияет на точность репарации.

Экспериментальные процедуры

Экстракт яиц лягушки

Задержанный CSF Яичный экстракт Xenopus laevis получали, как описано ранее (Postow et al., 2008). В экстракты яиц добавляли 10 мкг / мл нокодазола (Sigma Aldrich).

Выделение белка на гранулах ДНК

Гранулы ДНК получали, как описано ранее (Postow et al., 2008). Вкратце, вектор pBluescript SK + разрезали и заполняли Klenow (New England Biolabs), биотин-dATP и биотин-dUTP (Chemcyte) и связывали с динабусами M280 (Invitrogen).На каждый 1 мкг ДНК на шариках использовали 25–50 мкл экстракта. 35 S-меченый Ku80 был получен в лизате ретикулоцитов (Promega) с использованием кДНК X. laevis Ku80 (Postow et al., 2008) и разведен 1:10 в яичном экстракте. Гранулы удаляли из экстракта с помощью магнитного сепаратора частиц и элюировали денатурацией. Для анализов высвобождения Ku80 Ku80 определяли количественно с использованием фосфорно-визуализатора (Fujifilm).

Иммунопреципитации

Яичные экстракты с добавлением линейной ДНК (600 мкг / мл pBluescript SK +, расщепленные PvuII и SspI) и мутанты p97 инкубировали в течение указанного времени при 22 ° C.Экстракты разбавляли 1: 5 в буфере XB (10 мМ KCl, 10 мМ Hepes, pH 8, 50 мМ сахароза и 1 мМ MgCl 2 ) с добавлением 0,5% Triton X-100 и 1 мг / мл N-этилмалеимида и центрифугировали при 17000 g (5 мин; 4 ° C). Динабусы белка G, связанные с Ku80 или нормальным IgG, инкубировали в супернатантах в течение 1 ч при 4 ° C, элюируя в буфере для образцов SDS. Образцы анализировали с помощью вестерн-блоттинга.

pRPA Assay

Клетки U2OS предварительно обрабатывали миРНК в течение 48 часов или ингибиторами в течение 15 минут до того, как повреждение ДНК было индуцировано 1 мкМ камптотецином.После 1 ч обработки лизаты цельных клеток анализировали вестерн-блоттингом. См. Также Дополнительные экспериментальные процедуры.

Иммунофлуоресцентное окрашивание

Клетки U2OS выращивали на покровных стеклах и трансфицировали указанной миРНК с использованием RNAiMax (Life Technologies) в течение 48 часов или обрабатывали ингибитором в течение 15 минут перед воздействием ионизирующего излучения 10 Гр. Трансфекцию плазмид для эксперимента по восстановлению Ufd1 проводили за 24 ч до IR. Окрашивание Ku80 выполняли, как сообщалось ранее (Britton et al., 2013). Изображения были получены на Nikon Eclipse Ti-E с конфокальным вращающимся диском, конфокальным лазерным сканирующим микроскопом Leica TCS SP5 или микроскопом сверхвысокого разрешения Zeiss Elyra PS.1 со структурированным освещением (SIM), а автоматический анализ изображений выполнялся с помощью CellProfiler. См. Также Дополнительные экспериментальные процедуры.

Опухолевая модуляция ДНК-связывающей активности KU70 / 80 в биоптатах опухолей груди и мочевого пузыря человека

ДНК-связывающая активность в биопсиях опухолей молочной железы и мочевого пузыря человека

Для оценки ДНК-связывающей активности гетеродимера Ku70 / 80 в биопсиях опухолей , ядерные и цитоплазматические экстракты были приготовлены из восьми карцином груди и семи карцином мочевого пузыря.Протоковые или дольчатые карциномы молочной железы и переходно-клеточные карциномы мочевого пузыря (TCC) были охарактеризованы для классификации и определения стадии в соответствии с классификацией ВОЗ и метастазами опухолевых узлов. В таблице 1 приведены основные клинические и гистологические особенности. Процент мутировавшего р53, полученный иммуногистохимическим анализом, очевиден для образцов рака молочной железы.

Таблица 1 Клинические и опухолевые характеристики рака груди и мочевого пузыря

Ядерные и цитоплазматические экстракты из соответствующих нормальных тканей груди и мочевого пузыря использовали в качестве контроля.ДНК-связывающую активность оценивали с помощью EMSA. Доказательство специфичности связывания Ku70 / 80 было получено путем добавления козьих поликлональных антител против Ku70 и анти-Ku80.

В присутствии этих антител комплексы, связывающие конец ДНК, полностью сдвинуты и задерживаются в геле (рис. 1f), что указывает на то, что эти комплексы соответствуют гетеродимеру Ku. ДНК-связывающая активность всех ядерных экстрактов, показанных на фиг. 1, была нормализована для ДНК-связывающей активности Sp-1.

Рисунок 1

Ku70 / 80 ДНК-связывающая активность в нормальных и опухолевых ядерных экстрактах из тканей груди, мочевого пузыря и метастатических узлов. Электрофоретическая подвижность белковых комплексов ДНК анализировали, как описано в разделе «Материалы и методы». Гелевые сдвиги, характерные для трех независимых экспериментов, показаны на верхних панелях. Пациенты обозначены заглавными буквами (таблица 1). Для каждого пациента дорожка, обозначенная «n», загружена ядерным экстрактом из нормальной ткани, а дорожка «t» содержит ядерный экстракт опухолевой ткани.Положения свободного зонда и специфических комплексов белок-ДНК показаны стрелками. На нижних панелях показан сканирующий денситометрический анализ полос, соответствующих Ku-ДНК-связывающей активности, нормализованной для Sp-1-ДНК-связывающей активности. Значения по оси y являются средними ± стандартное отклонение. из трех независимых экспериментов. ( a, b ) ДНК-связывающая активность Ku70 / 80 в ядерных экстрактах из нормальных («n») и опухолевых («t») тканей груди. Дорожки F, G 1 и G 2 соответствуют пациентам с двусторонними опухолями молочной железы.( c, d ) Ku70 / 80 ДНК-связывающая активность в ядерных экстрактах из тканей рака мочевого пузыря человека и из нормальных тканей тех же доноров. В c полоса, обозначенная p , содержит ядерный экстракт перитуморальной ткани, непосредственно рядом с неопластическим поражением пациента J. Опухолевый экстракт (полоса J ‘t’) показывает активность выше, чем перитуморальная (в три раза) и нормальные ткани (восемь раз). ( d ) Пациент «Q» не имел рака, как описано в результатах.( e ) EMSA для ядерных экстрактов первичных опухолей молочной железы (t) и метастатических узлов пациентов A, B и G. Был также проанализирован один нормальный узел (n) пациента A. Среднее ± стандартное отклонение. значения из трех независимых экспериментов представлены на нижней панели. ( f ) Сверхсдвиг активности концевого связывания, полученный с использованием антител против Ku70 (дорожка 2) и анти-Ku80 (дорожка 3). Ядерные экстракты взяты из клеточной линии CaCo-2 (дорожка 1: белковый экстракт без антител). Дорожка «P»: зонд без белкового экстракта

Ядерные экстракты из опухолевых тканей демонстрировали два разных образца Ku-ДНК-связывающей активности (фиг. 1).Десять из 15 опухолей показали высокую активность связывания Ku по сравнению с нормальными тканями, независимо от происхождения мочевого пузыря или молочной железы. Напротив, снижение активности гетеродимера было обнаружено в 5/15 первичных опухолях молочной железы и мочевого пузыря и в 3/3 метастатических узлов рака молочной железы по сравнению с соответствующими нормальными тканями (рис. 1). Экстракты клеточной линии CaCo-2 использовали в качестве стандарта для сравнения активности в различных гелях. Двусторонний тест Стьюдента t был проведен для оценки статистической значимости разницы между нормальными и опухолевыми образцами.

В пяти опухолях молочной железы и пяти опухолях мочевого пузыря ДНК-связывающая активность была в 3–10 раз выше (рис. 1: пациенты A – E и пациенты I – M) по сравнению с нормальными тканями ( P <0,00004). Все опухоли молочной железы этой группы были классифицированы как T1, G1 – G2 согласно классификации ВОЗ и TNM (таблица 1) и имели менее агрессивный клинический фенотип. Опухоли мочевого пузыря были неинвазивными или инфильтрирующими подслизистую основу (Ta – T1, G1 – G2) (Таблица 1). Все нормальные ткани проявляли очень низкий базальный уровень ДНК-связывающей активности.

Вторая группа опухолей, характеризующаяся пониженной активностью связывания Ku, была связана с более продвинутым прогрессированием в соответствии с стадией и / или классификацией опухоли. Три агрессивные синхронные двусторонние опухоли молочной железы (G3 – G2, T2) (Таблица 1: F, G 1 и G 2 ) и две уротелиальные карциномы, сильно инфильтрирующие стенку мочевого пузыря (G3, T3) (Таблица 1: N, O) показали снижение ДНК-связывающей активности в 1,5–3 раза по сравнению с их нормальными аналогами ( P <0.001) (рис.1, пациенты F, G 1 , G 2 , N, O). Аналогичный образец активности Ku был получен в лимфатических узлах пациентов A, B и G. В метастатических подмышечных узлах этих пациентов активность связывания ДНК была снижена (в 2,5–4,5 раза) по сравнению с соответствующими первичными опухолями. и к гистопатологически нормальному узлу (метастазы по сравнению с первичными опухолями: P <0,0002) (рисунок 1e).

Ku ДНК-связывающая активность была также проанализирована в ткани мочевого пузыря с гистологическим диагнозом хронического воспаления у здорового от рака пациента (рис. 1, пациент Q).ДНК-связывающая активность полностью отсутствовала как в патологических, так и в нормальных тканях.

Опухоли с менее агрессивным поведением проявляли высокую ДНК-связывающую активность в ядрах по сравнению с нормальными тканями. Более того, как запущенные, так и метастатические опухоли показали существенное снижение ДНК-связывающей активности Ku70 / 80.

Эти результаты подчеркивают значительное расхождение активности связывания Ku-ДНК в менее агрессивных или инвазивных и метастатических опухолях и их нормальных аналогах.

Ku70 / 80 ДНК-связывающая активность в нормальных цитоплазматических экстрактах и ​​экстрактах опухоли

Чтобы оценить, присутствует ли ДНК-связывающая активность в других клеточных компартментах, мы проанализировали цитоплазматические экстракты тех же пациентов. Результаты показаны на фиг. 2. Практически во всех нормальных тканях ДНК-связывающая активность Ku70 / 80 была едва обнаружена, тогда как цитоплазматические экстракты из опухолей груди и мочевого пузыря показали высокую ДНК-связывающую активность. На рис. 2 показано 2–10-кратное увеличение активности Ku70 / 80 при семи раковых опухолях молочной железы и четырех раках мочевого пузыря (рис. 2, пациенты A – F, G 2 , I, J, L, M) по сравнению с соответствующие элементы управления.Все экстракты цитоплазмы опухоли показали одинаковый уровень ДНК-связывающей активности. Наибольшая активность гетеродимера была обнаружена в цитоплазматическом экстракте двустороннего рака молочной железы (рис. 2, пациентка F). У здорового от рака пациента была обнаружена очень низкая активность, как и в других нормальных тканях (рис. 2, пациент Q). Чтобы убедиться в отсутствии загрязнения ядерными белками, ДНК-связывающую активность Sp-1 анализировали в цитоплазматических экстрактах нормальных и опухолевых тканей молочной железы (рис. 2с).

Рисунок 2

Ku70 / 80 ДНК-связывающая активность в цитоплазматических экстрактах из тканей груди и мочевого пузыря.Денситометрический анализ Ku-ДНК-связывающей активности в цитоплазматических экстрактах молочной железы ( a ) и мочевого пузыря ( b ) в нормальных (n), опухолевых (t) и перитуморальных (p) тканях представлен гистограммами. Заглавные буквы на оси x обозначают пациентов, как в таблице 1. Значения представляют собой средние значения ± стандартное отклонение. трех независимых экспериментов. Экстракты клеточной линии CaCo-2 использовали в качестве стандарта для сравнения активности в различных гелях. У пациента J ДНК-связывающая активность также обнаруживается в проанализированной перитуморальной ткани.Отрицательный контроль показывает отсутствие ДНК-связывающей активности (пациент Q). ( c ) ДНК-связывающая активность Sp-1, выполняемая, как описано в разделе «Материалы и методы», в ядерных (дорожки 1, 2) и цитоплазматических (дорожки 3, 4) экстрактах от пациентки с раком молочной железы А. дорожка ‘P’ : зонд без белкового экстракта

Экспрессия белков p70 и p80 в нормальных и опухолевых тканях

Чтобы определить, является ли различная ДНК-связывающая активность в нормальной и опухолевой тканях следствием разного продуцирования белков p70 и p80 или модуляции Гетеродимерную активность, ядерные уровни белков Ku70 и Ku80 исследовали с помощью вестерн-блоттинга в тех же экстрактах.Экспрессия двух субъединиц (определенная денситометрически) всегда находилась в соотношении 1: 2 (p80: p70) как в нормальных, так и в опухолевых тканях, что предполагает возможность того, что p80 может быть ограничивающим фактором для образования гетеродимеров.

Фигура 3 показывает ядерную экспрессию p70 и p80 в опухолях и в соответствующих нормальных тканях (Рисунок 3b, c). Репрезентативный вестерн-блоттинг показывает различия между нормальными и опухолевыми ядерными экстрактами из образцов молочной железы по уровням белка p70. Ядерные уровни Sp-1 показаны в качестве контрольных образцов (рис. 3а).Экспрессию белка также анализировали в трех метастатических узлах и одном нормальном узле (рис. 3d).

Рисунок 3

Ядерная экспрессия p70 и p80 в тканях груди, мочевого пузыря и метастатических узлов. ( a ) Вестерн-блоттинг с использованием антител против Ku70 или против Sp-1 в нормальных (n) и опухолевых (t) ядерных экстрактах ткани груди (пациенты A – D, F, G 1 , G 2 ) ( b , c , d ) Гистограммы представляют собой сканирующий денситометрический анализ Вестерн-блоттинга, выполненный, как описано в разделе «Материалы и методы».Каждое значение было нормализовано для уровней белка Sp-1 и представляет собой среднее значение (± стандартное отклонение) трех независимых экспериментов. ( b ) Уровни экспрессии ядерных субъединиц p70 и p80 в экстрактах нормальных (n) и опухолевых (t) ядер груди. Заглавные буквы на оси x обозначают пациентов (таблица 1). ( c ) уровни p70 и p80 из ядерных экстрактов тканей мочевого пузыря; «N», «t» и «p» обозначают нормальные, опухолевые и перитуморальные ткани соответственно. ( d ) Уровни p70 и p80 из ядерных экстрактов первичных опухолей молочной железы (t) и метастатических узлов (m) пациентов A, B и G.Также анализируется один нормальный узел (n) пациента A

В пяти опухолях молочной железы (рис. 3, образцы A – E) белки p70 и p80 экспрессировались в экстрактах опухолей, но отсутствовали или экспрессировались на очень низком уровне в нормальных тканях. . В экстрактах опухолей наблюдалось 4-18-кратное увеличение экспрессии белка по сравнению с нормальными тканями (рис. 3b, образцы A – E). Напротив, никаких существенных различий в экспрессии белка между опухолями и их нормальными аналогами не было обнаружено ни в одном проанализированном образце мочевого пузыря (рис. 3b, образцы I – M).

В ядерных экстрактах из трех двусторонних образцов молочной железы (F, G 1 , G 2 ) и из двух высокоинвазивных TCC (N, O) две субъединицы присутствовали на одном уровне как в нормальных, так и в опухолевых тканях. Рисунок 3). Уровни белка не коррелировали с активностью связывания гетеродимера. Метастатические ткани показали аналогичное поведение; фактически, p70 и p80 оба присутствовали в метастатических узлах, в тканях первичной опухоли и в одном нормальном узле (фигура 3d, образцы A, B и G 2 ), без какой-либо корреляции с соответствующей активностью Ku70 / 80.

Корреляция между ДНК-связывающей активностью, уровнями белка и стадией опухоли

Были идентифицированы три различных паттерна, сочетающих как экспрессию Ku, так и активность с характеристиками опухоли (таблица 2).

Таблица 2 Корреляция между Ku-ДНК-связывающей активностью, уровнями белка p70 / p80 и характеристиками опухоли

В первой группе, включающей менее агрессивные образцы рака молочной железы, уровни экспрессии Ku70 и Ku80 совпадали с сопутствующим повышением ядерной ДНК-связывающей активности (Рисунки 1 и 3, пациенты A – D).

Не было обнаружено корреляции между уровнями белка и соответствующей связывающей активностью в неинвазивных переходно-клеточных карциномах, составляющих вторую группу. В этих образцах активность связывания гетеродимера была повышена во всех экстрактах ядерных опухолей, хотя не было различий в уровнях белка между опухолевыми и нормальными тканями (Рисунки 1 и 3, образцы I – M).

Третья группа, состоящая из двусторонних синхронных опухолей молочной железы, сильно инфильтрирующего рака мочевого пузыря и тканей метастатических узлов, не показала корреляции между уровнями белка и связывающей активностью, которая снижалась во всех экстрактах опухолей и метастатических узлов, хотя p70 и p80 уровни не показали значительных различий между нормальной и опухолевой тканями (Фигуры 1 и 3, образцы F, G 1 , G 2 , N, O).

Для динамической сборки комплексов соединения концов необходимо взаимодействие Ku70 / 80 и XRCC4

Аннотация

Восстановление двухцепочечных разрывов ДНК (DSB) путем негомологичного соединения концов (NHEJ) требует сборки нескольких белков на концах ДНК. Хотя биохимические исследования пролили свет на некоторые аспекты механизма реакции NHEJ, о NHEJ в живых клетках известно гораздо меньше, в основном из-за невозможности визуализировать репаративные белки NHEJ при повреждении ДНК.Здесь мы приводим доказательства того, что импульсный лазер ближнего ИК-диапазона может производить DSB без каких-либо видимых изменений в ядре, и мы показываем, что белки NHEJ накапливаются в облученных областях. Уровни DSBs и накопления Ku уменьшаются со временем, показывая, что этот подход позволяет нам изучать кинетику репарации ДНК in vivo . Примечательно, что гетеродимеры Ku на концах ДНК находились в динамическом равновесии с Ku70 / 80 в растворе, показывая, что сборка комплекса NHEJ обратима. Накопление XRCC4 / лигазы IV на DSB зависело от присутствия Ku70 / 80, но не ДНК-PK CS .Мы обнаружили прямое взаимодействие между Ku70 и XRCC4, которое могло бы объяснить эти требования. Наши результаты предполагают, что эта сборка составляет ядро ​​реакции NHEJ и что XRCC4 может служить гибкой связью между Ku70 / 80 и лигазой IV.

Стабильность генома всех живых организмов постоянно находится под угрозой из-за агентов, повреждающих ДНК, таких как ионизирующее излучение, УФ-свет и генотоксичные химические вещества. Двухцепочечные разрывы ДНК (DSB) являются особенно опасными повреждениями, поскольку они могут вызвать потерю гетерозиготности или хромосомные транслокации, что в конечном итоге может привести к раку или гибели клеток (1).Эукариоты разработали по крайней мере два разных пути репарации, которые могут иметь дело с этими повреждениями, гомологичная рекомбинация и негомологичное соединение концов (NHEJ). Гомологичная рекомбинация нуждается в гомологичной матрице для управления процессом репарации, тогда как NHEJ использует небольшую гомологию или ее отсутствие для репарации DSB.

Ядро механизма NHEJ включает комплекс ДНК-зависимой протеинкиназы (ДНК-PK) и лигазу IV / XRCC4. Пациенты и модели мышей с дефектом одного из этих компонентов демонстрируют чувствительность к ионизирующему излучению и дефектную иммунную систему, вызванную неспособностью проводить рекомбинацию V (D) J (2).

DNA-PK состоит из связывающего конец ДНК гетеродимера Ku70 / 80 и каталитической субъединицы ДНК-PK (DNA-PK CS ), которая фосфорилирует большое количество субстратных белков по остаткам серина и треонина после индукции DSB (3 ). Хотя было описано большое количество субстратов DNA-PK, единственным событием фосфорилирования, которое, как было доказано, является функционально значимым, является аутофосфорилирование ДНК-PK CS (4). ДНК-ПК, связанная с концами ДНК, может сопоставлять эти концы в синаптический комплекс (5).Однако концы ДНК недоступны для процессинговых факторов или ДНК-лигазы, если только ДНК-PK CS не будет сначала аутофосфорилирован (6-8). Соединение концов ДНК осуществляется лигазой IV / XRCC4 (9, 10). Этот процесс, вероятно, стимулируется недавно идентифицированным белком XLF / Cernunnos, который связывается с XRCC4 (11, 12).

Хотя биохимические исследования пролили свет на некоторые аспекты механизма реакции NHEJ, гораздо меньше известно о NHEJ в живых клетках, в основном из-за невозможности визуализировать локализацию белков репарации NHEJ при повреждении ДНК.Недавно было показано, что NHEJ и белки гомологичной рекомбинации накапливаются при повреждении ДНК, вызванном сфокусированными лазерными лучами (13-15). Здесь мы приводим доказательства того, что импульсный лазер ближнего ИК-диапазона (NIR) может производить DSB в ядре и что белки NHEJ накапливаются в облученных областях. Мы наблюдали, что связывание гетеродимеров Ku с DSBs является динамическим процессом, включающим временные ассоциации с концами ДНК. Рекрутирование комплекса лигаза IV / XRCC4 происходит даже в отсутствие ДНК-PK CS , что можно объяснить прямым взаимодействием Ku70-XRCC4.

Результаты

Характеристика клеток, экспрессирующих EGFP-Ku80.

Хотя было сделано много попыток воссоздать реакцию NHEJ in vitro , все еще неясно, насколько хорошо эти реакции напоминают DSB repair in vivo . Поэтому мы изучали NHEJ в живых клетках с использованием биологически активных белков с флуоресцентной меткой. Мы создали Ku80-дефицитную клеточную линию китайского хомячка, экспрессирующую EGFP-Ku80 (рис.7, который опубликован в качестве вспомогательной информации на веб-сайте PNAS). Белок EGFP-Ku80 гетеродимеризован с Ku70 хомяка, и не было обнаружено никаких признаков EGFP или других продуктов деградации, что подтверждает, что сигнал GFP действительно может быть использован для визуализации слитого белка Ku80. Функциональность EGFP-Ku80 была продемонстрирована анализами выживаемости γ-лучей, соединения концов и V (D) J-рекомбинации (рис. 8, который опубликован в качестве вспомогательной информации на веб-сайте PNAS).

Мы впервые исследовали диффузию EGFP-Ku80 через ядро ​​путем восстановления флуоресценции после фотообесцвечивания (FRAP) (16).Флуоресценция ядерных EGFP и EGFP-Ku80 восстановилась примерно до того же уровня, что означает, что подавляющее большинство Ku70 / 80 не было связано с неподвижными структурами в ядре (рис.9 и 10, которые опубликованы в качестве подтверждающей информации о Веб-сайт PNAS). Кроме того, флуоресценция EGFP-Ku80 восстанавливалась с кинетикой, сравнимой с кинетикой двух других белков с аналогичной молекулярной массой, ERCC1 / XPF и XPG (A. Zotter и W. Vermeulen, личное сообщение), показывая, что большая часть гетеродимера Ku70 / 80 не является частью более крупного белкового комплекса (рис.9).

Накопление Ku70 / 80 на концах ДНК.

Мы использовали импульсный NIR-лазер для исследования накопления Ku70 / 80 после индукции DSB в небольшой ядерной области (17). Узор из параллельных линий сканировали через клетки, создавая «цилиндр повреждения» диаметром <1 мкм через ядра. Почти все клетки в облученной области проявляли полосу окрашивания γ-h3AX. Наличие концов ДНК в этой области было подтверждено также окрашиванием TUNEL и накоплением белка Ku80 (рис.1 А ). Накопление Ku было максимальным в поврежденных областях с наибольшим содержанием ДНК, что позволяет предположить, что Ku может эффективно взаимодействовать с гетерохроматином (рис. B ). Мы также выбрали клетки от прометафазы до анафазы и сканировали единственную линию повреждений через ядро. После этого лечения мы наблюдали быстрое накопление Ku70 / 80 там, где лазерный путь пересекался с конденсированными хромосомами, показывая, что даже эта высококонденсированная форма хроматина поддерживает связывание белков Ku с DSB (рис.1 С ).

Рисунок 1.

Накопление белков NHEJ при лазерном повреждении. ( A ) Накопление Ku80, EGFP-Ku80, γ-h3AX и окрашивания TUNEL в клетках V79B после лазерного облучения. На крайних левых панелях показано положение лазерного повреждения серыми пунктирными линиями. ( B ) Интенсивность накопления EGFP-Ku80 коррелирует с ДНК-плотными гетерохроматическими областями.Плотность хроматина выявляется по ДНК-красителю DRAQ5, введенному после лазерного облучения. Изображение было снято через 30 мин после облучения. ( C ) Доступность конденсированных хромосом для связывания конца ДНК EGFP-Ku80. Изображение было снято через 10 мин после облучения. ( D ) Типичное деление клеток XR-V15B, экспрессирующих EGFP-Ku80. Время в часах после облучения указано в каждом кадре. (Масштаб: 5 мкм.)

В отличие от того, что наблюдалось с другими протоколами лазерно-индуцированного повреждения ДНК (14, 18), повреждений ядра после облучения NIR-лазером в проходящем свете или после окрашивания DAPI, ToPro3 или Draq5 не наблюдалось.Более того, через 2 часа после лазерного облучения клеточные мембраны во всех клетках оставались неповрежденными (исключение трипанового синего), и клетки, которые были повреждены, могли осуществлять деление клеток (рис. D ).

Для кинетических измерений облучение лазером в ближнем инфракрасном диапазоне ограничивалось небольшим диском, а не одной линией (рис. А ). EGFP-Ku80 начал накапливаться в этой поврежденной области в течение нескольких секунд и достиг 95% от своего максимума через ≈3 мин (рис.2 B ), предполагая, что большинство концов ДНК рекрутировали Ku70 / 80 в пределах этого временного диапазона.

Рис. 2.

Взаимодействие Ku70 / 80 с DSB in vivo . ( A ) Пример накопления EGFP-Ku80 после лазерного облучения диска внутри ядра клеток XR-V15B, экспрессирующих EGFP-Ku80.( B ) Кривая накопления EGFP-Ku80 при лазерном повреждении ДНК. Для каждой клетки уровень флуоресценции перед повреждением был установлен на 0, а максимум был установлен на 1. Среднее и удвоенное SEM для всего не менее 10 клеток отображено на графике. ( Вставка ) Более подробно показано накопление Ku между 0 и 8 мин в необработанных клетках. Закрашенные кружки представляют необработанные клетки, а белые треугольники представляют клетки, обработанные вортманнином. ( C ) Пример FRAP на локальном накоплении EGFP-Ku80.( D ) FRAP на кривой местного повреждения для EGFP-Ku80. Данные были нормализованы до уровня флуоресценции до отбеливания. Среднее значение и удвоенное SEM из 10 независимых кривых FRAP изображены на графике. Белые кружки представляют собой кривую FRAP, а закрашенные кружки показывают потерю флуоресценции из-за продолжающейся репарации (от B ). (Масштаб: 5 мкм.)

Мы сравнили кинетику репарации DSB с уровнями накопления EGFP-Ku80 при лазерно-индуцированном повреждении ДНК (19).После быстрого накопления уровень Ku постепенно снижался в течение следующих 2 ч (рис. B ). Примерно 20% начального накопления Ku осталось через 2 часа, что аналогично ранее сообщавшимся 20–30% DSB, остающимся через 2 часа после ионизирующего излучения. В присутствии ингибитора ДНК-PK вортманнина наблюдалась гораздо более медленная потеря накопления флуоресценции, подтверждая, что это уменьшение накопления Ku действительно было результатом продолжающейся репарации DSB (рис.2 B ).

Чтобы лучше понять взаимодействие Ku70 / 80 и концов ДНК, мы исследовали динамику накопления белка в поврежденной области ядра. Накопленный EGFP-Ku80 обесцвечивался и контролировалось восстановление флуоресценции (рис. 2). С ). Мы обнаружили, что сигнал GFP восстановился до ≈75% от исходного относительного уровня в течение 8 мин (рис. D ), предполагая, что Ku70 / 80 находился на конце ДНК с периодом полураспада ≈2 мин.Доля EGFP-Ku80, которая не восстановилась в течение этого периода времени, может быть связана с уменьшением количества доступных концов ДНК из-за продолжающейся репарации ДНК.

Взаимозависимость белков NHEJ для накопления на DSB.

Впоследствии мы расширили наш анализ на другие белки NHEJ. ДНК-PK CS , лигаза IV и XRCC4, как было обнаружено, также накапливаются в сайтах лазерно-индуцированного повреждения (фиг. 3), что указывает на то, что все основные белки NHEJ могут быть рекрутированы в DSB.Накопление этих белков было видно практически в каждом ядре этих экспоненциально растущих клеток, показывая, что притяжение к DSB по существу не зависит от клеточного цикла (данные не показаны).

Рис. 3.

Накопление белков NHEJ при лазерном повреждении. Иммунофлуоресцентное окрашивание проводили с использованием антител к фосфорилированной Т2609 ДНК-PK CS в клетках HeLa или XRCC4 в клетках хомяка V79B.EGFP-лигаза IV была непосредственно визуализирована в первичных фибробластах человека, полученных от пациента с SCID с мутацией лигазы IV, которая делает эндогенный белок нестабильным. (Масштаб: 5 мкм.)

Впоследствии мы исследовали взаимозависимость белков NHEJ для накопления на DSB. Накопление Ku в поврежденной области не зависит от присутствия ДНК-PK CS или XRCC4, как и ожидалось (рис. A и B ).Комплекс лигаза IV / XRCC4 действует поздно в реакции NHEJ, что позволяет предположить, что он может быть задействован при взаимодействии с ДНК-PK. Мы обнаружили, что накопление XRCC4 в поврежденных областях действительно совмещено с сигналом GFP в клетках XR-V15B, экспрессирующих EGFP-Ku80, и что клетки с неопределяемым уровнем экспрессии EGFP-Ku80 не демонстрируют видимого накопления XRCC4 (рис. 4). С ). Интересно, что мы заметили, что белок DNA-PK CS не требуется для накопления XRCC4 (рис.4 D ).

Рис. 4.

Взаимозависимость сборки белка NHEJ от DSB. ( A и B ) Накопление Ku80 (зеленый) в XRCC4-дефицитных клетках XR-1 ( A ) и в мутантных ДНК-PK CS клетках XR-C1 ( B ). ( C и D ) Накопление белка XRCC4 в клетках XR-V15B, экспрессирующих EGFP-Ku80 ( C ), и в клетках XR-C1 с дефицитом ДНК-PK CS ( D ).Стрелки в C указывают на клетки, которые не экспрессируют EGFP-Ku80. (Масштаб: 5 мкм для A , B и D и 20 мкм для C .)

Прямое взаимодействие между Ku70 / 80 и XRCC4.

Мы подтвердили предыдущее открытие, что Ku70 / 80 взаимодействует с комплексом лигаза IV / XRCC4, выполняя иммунопреципитацию XRCC4 ядерных экстрактов клеток HeLa (20). Примерно 4% Ku70 / 80 коиммунопреципитировалось с XRCC4 независимо от обработки ионизирующим излучением перед приготовлением экстракта (рис.5 A ), показывая, что на это взаимодействие не влияет индукция DSB.

Рис. 5.

Прямое взаимодействие Ku70 и XRCC4. ( A ) Иммунопреципитация из экстрактов ядер клеток HeLa с использованием антисыворотки XRCC4. ( Верхний ) Исходный материал (10%). ( Нижний ) Вестерн-блот иммунопреципитированного материала.В — необлученные клетки; ИК — клетки, облученные гамма-лучами 45 Гр. ( B ) Схематическое изображение трифункционального сшивающего агента сульфо-SBED. ( C ) Сшитые полипептиды после инкубации Ku70 / 80, меченного сульфо-SBED, с XRCC4 с последующей фотоактивацией сшивающего агента. УФ-сшивание проводили только с Ku70 / 80 (дорожка 1), только с XRCC4 (дорожка 2) или Ku70 / 80 и XRCC4 (дорожки 3 и 4). Продукты на дорожке 3 обрабатывали DTT, чтобы обратить поперечное сшивание. Размеры маркеров молекулярной массы изображены слева, а природа различных продуктов в геле подтверждена масс-спектрометрией (MALDI-TOF).( D ) Продукты, которые могли быть присоединены к арилазидной группе сульфо-SBED, которая была связана с Ku70 / 80. Смеси содержали Ku70 / 80, ДНК-PK CS , лигазу IV / XRCC4 и ДНК. Дорожка 1 показывает только препарат Ku70 / 80, а дорожка 2 показывает несвязанные белки. Дорожка 4 показывает продукты, которые были осаждены с использованием гранул стрептавидина после активации арилазидной группы и обработки DTT, а дорожка 3 показывает продукты, связанные со стрептавидином, без активации или обработки DTT.

Предыдущие эксперименты показали, что взаимодействие Ku – XRCC4 было слабым или отсутствовало (20). Поэтому мы разработали метод переноса аффинной метки с перекрестным фото-перекрестным связыванием, который позволяет обнаруживать временные взаимодействия. Мы пометили гетеродимер Ku70 / 80 фото-сшивающим реагентом Sulfo-SBED, который содержит сложный эфир сульфо-NHS ​​(который может образовывать ковалентную связь с остатками лизина), арилазидную группу (которая может быть фотоактивирована) и биотиновый фрагмент (рис.5 B ). Комплекс Ku70 / 80 / Sulfo-SBED инкубировали с экстрактами ядер клеток HeLa с последующим масс-спектрометрическим анализом сшитых белков. При фотоактивации может образовываться ковалентная связь между взаимодействующими белками, расположенными на расстоянии 20 Å. Мы обнаружили предпочтительное удерживание XRCC4 (данные не показаны), что позволяет предположить, что Ku70 / 80 напрямую взаимодействует с XRCC4. Затем рекомбинантный XRCC4 инкубировали с комплексом Ku / Sulfo-SBED. Мы обнаружили, что Ku70 / 80 взаимодействует с XRCC4 в отсутствие ДНК-PK CS , лигазы IV и ДНК (рис.5 С ). Помимо комплексов Ku70 / 80, мы обнаружили сшитый продукт, в котором пептиды Ku70 и XRCC4 можно было идентифицировать с помощью масс-спектрометрии (рис. C , дорожка 4). Затем мы исследовали структуру перекрестного сшивания, когда присутствовали ДНК-PK CS и комплекс XRCC4 / лигаза IV. В этом эксперименте плечо сшивающего агента, которое первоначально было прикреплено к Ku70 / 80, было отщеплено обработкой DTT после фото-сшивания. Фрагмент биотина на третьем плече трифункционального сшивающего агента использовали для очистки любых прикрепленных белков, которые затем анализировали с помощью SDS / PAGE.Даже в этом случае сшитым был в основном XRCC4, хотя весь XRCC4 находился в комплексе с лигазой IV (рис. D ). В заключение, наши объединенные данные in vivo, и in vitro, показывают, что XRCC4 напрямую взаимодействует с Ku70, что может быть необходимо для всех продуктивных комплексов NHEJ.

Обсуждение

Мы исследовали сборку комплексов NHEJ в условиях in vivo, и in vitro, .Мы наблюдали, что рекрутирование Ku70 / 80 на DSB не требует присутствия каких-либо других основных факторов NHEJ и начинается в течение нескольких секунд после индукции повреждения ДНК. Накопленные гетеродимеры Ku могут обмениваться с растворимой фракцией, показывая, что Ku на концах ДНК находится в динамическом равновесии с белком в растворе. Мы обнаружили, что Ku70 / 80, но не ДНК-PK CS , необходим для накопления XRCC4 в DSB, что объясняется нашим наблюдением прямого взаимодействия между полипептидами XRCC4 и Ku70.Взятые вместе, эти результаты подтверждают мнение, что ядро ​​всех комплексов NHEJ вращается вокруг взаимодействия Ku-XRCC4.

Индукция DSB лазером.

Исторически DSB вводились с помощью ионизирующего излучения или радиомиметических препаратов. В последнее время для индукции повреждения ДНК в клетках используются различные типы мощных лазеров (21). Типичный подход к локальному повреждению ДНК в клетках заключается в использовании лазера УФ-А, часто в сочетании с агентами, повышающими чувствительность ДНК.Эти подходы оказались ценными для исследования репарации ДНК. Однако пресенсибилизация ДНК может потенциально влиять на исследуемые процессы репарации ДНК (21). Кроме того, в ядре по пути лазерного луча (а не только в фокусной точке) будет возникать различное количество повреждений ДНК, что может привести к нежелательным структурным повреждениям клеточных мембран. По этим причинам мы выбрали облучение клеток импульсным лазером NIR (800 нм) без использования сенсибилизирующих ДНК агентов.Живые ткани поглощают очень мало энергии на этой длине волны (22), что должно свести к минимуму фототоксичность и накопление тепла (17). Более того, многофотонные события, которые, как ожидается, будут необходимы для индукции ДР, будут происходить только вблизи фокуса лазерного луча (17).

Некоторые из наших экспериментов подтверждают мнение, что этот метод индукции DSB может быть использован для изучения NHEJ in vivo . Во-первых, все протестированные нами белки NHEJ были задействованы в поврежденной области.Во-вторых, накопление XRCC4 зависело от присутствия Ku70 / 80, исключая специфическую агрегацию как причину накопления, индуцированного лазером. В-третьих, накопление Ku70 / 80 динамически поддерживалось, что также свидетельствует против конкретных событий. Наконец, уменьшение накопления Ku и репарация индуцированных ионизирующим излучением DSB демонстрируют сходную кинетику и могут блокироваться ингибитором ДНК-PK вортманнином (19). Таким образом, мы пришли к выводу, что локальное повреждение ДНК, вызванное NIR, является настоящей модельной системой для изучения механизмов репарации DSB в живых клетках.

Взаимодействие Ku70 / 80 с концами ДНК.

Мы обнаружили однородное распределение EGFP-Ku80 по всему ядру (кроме ядрышка), а анализ FRAP показал свободное перемещение Ku70 / 80 через нуклеоплазму. Это последнее наблюдение заметно отличается от недавно опубликованного исследования, в котором рассматривается ассоциация белков Ku с ядерным матриксом (23). Хотя причина этого несоответствия еще не решена, это может быть объяснено разными уровнями экспрессии (мы использовали стабильные клоны, в отличие от временной экспрессии), другой формой GFP-слитого белка (N-концевое мечение в этом исследовании по сравнению с C-терминальная маркировка) и / или различие в методе анализа FRAP (мы использовали полосу FRAP вместо точечной FRAP).Хотя наше исследование проводилось на клетках хомяка, мы получили очень похожие результаты на клетках HeLa (данные не показаны). Поскольку в нашем исследовании используется меченый белок, который полностью активен в NHEJ и содержит внутренне контролируемое сравнение с другими меченными EGFP белками, которые были измерены с теми же настройками микроскопа, мы пришли к выводу, что Ku70 / 80 относительно беспрепятственно диффундирует в нуклеоплазму до тех пор, пока он встречает конец ДНК.

Наш анализ накопления EGFP-Ku80 на лазерно-индуцированных DSB показывает, что сборка комплекса NHEJ in vivo является очень динамичным процессом (см. Модель на рис.6). В самом деле, фотообесцвечивание локально накопленных Ku70 / 80 показало, что связанные белки могут обмениваться в течение 10 минут, что позволяет предположить, что сборка комплекса NHEJ обратима. Хотя мы не можем формально исключить возможность того, что (часть) Ku70 / 80 косвенно связывается с концами ДНК, некоторые наблюдения утверждают, что наш анализ отражает свойство гетеродимеров Ku, связанных с концами ДНК. Во-первых, кривые накопления и FRAP совместимы с кинетикой ассоциации / диссоциации, которую можно ожидать, когда существует только один связывающий субстрат (например,g., моноэкспоненциальное поведение без задержки накопления). Во-вторых, если Ku не мог диссоциировать от концов ДНК до того, как произошло лигирование, это привело бы к неподвижной фракции в экспериментах с FRAP, если вся репарация не была завершена в течение 15-минутного периода измерения. Однако такая неподвижная фракция не наблюдалась, и по кинетике восстановления DSB после ионизирующего излучения можно сделать вывод, что восстановление DSB занимает гораздо больше времени для завершения. Однако часть Ku, связанная по концам ДНК, ниже 10% от общего количества иммобилизованных гетеродимеров Ku не будет обнаружена в нашем анализе.Тем не менее, мы не поддерживаем идею о том, что большая часть молекул Ku косвенно связывается с одним DSB, потому что накопление ≈50–100 молекул GFP-Ku будет видно как ядерные фокусы (24), которые никогда не наблюдались.

Рис. 6.

Рабочая модель для стыковки различных типов ДНК DSB. Во-первых, распознавание DSB с помощью Ku70 / 80 происходит быстро и обратимо.Впоследствии XRCC4 / лигаза IV может привлекаться, образуя обратимый комплекс. Альтернативно, ДНК-PK CS и XRCC4 / лигаза IV могут быть задействованы и образовывать более стабильный комплекс. Мы предполагаем, что реакция присоединения простых DSB может быть достигнута через любой из этих двух промежуточных продуктов, тогда как сложные DSB могут быть присоединены только через правую ветвь.

Сборка комплексов NHEJ

in Vivo .

Наши данные подтверждают модель, в которой Ku70 / 80 непосредственно опосредует включение лигазы IV / XRCC4 в комплексы с соединением концов.ДНК-PK CS и ферменты, обрабатывающие ДНК, могут быть задействованы в этих основных комплексах при необходимости. Белок XRCC4, скорее всего, функционирует как универсальный адаптер для привлечения и позиционирования лигазы, а также других белков процессинга ДНК, что очень похоже на роль XRCC1 в эксцизионной репарации оснований (25). Взаимодействие XRCC4 с полинуклеотидкиназой было недавно показано, предполагая, что XRCC4 может также служить для привлечения процессинговых факторов, которые помещают XRCC4 в самое сердце механизма NHEJ, а не просто служат кофактором для лигазы IV (26).Эта точка зрения, безусловно, согласуется с тяжелым фенотипом мышей и клеток с дефицитом XRCC4 (27, 28), даже для присоединения простых тупых DSB (29). Адаптерная функция XRCC4 также объясняет, почему консервация этого белка у дрожжей и млекопитающих настолько низка (30), несмотря на его важную функцию: дивергентные взаимодействия у дрожжей и млекопитающих потребуют другого аминокислотного состава, даже если функция адаптера очень консервативен.

Предыдущие исследования взаимодействий между факторами NHEJ показали, что Ku70 / 80 в первую очередь взаимодействует с лигазой IV, а DNA-PK CS — с XRCC4 (20).Возможно, что взаимодействие между Ku70 / 80 и XRCC4 нестабильно в условиях, используемых Hsu et al. Однако очевидно, что XRCC4 привлекается к DSB in vivo в отсутствие ДНК-PK CS . Привлечение дрожжевого комплекса Dnl4 / Lif1 в отсутствие гомолога ДНК-PK CS (31) и относительно мягкий фенотип дефицита ДНК-PK CS также согласуется с незначительной ролью этого белка в привлечении комплекс лигаза IV / XRCC4 (19, 29).Однако следует ожидать, что взаимодействия лигазы IV с ДНК и / или белками вносят вклад в стабильность комплексов NHEJ.

Важным вопросом, который еще не решен полностью, является порядок сборки белка NHEJ в DSB in vivo . Ожидается, что белки DNA-PK CS и XRCC4 будут связываться с концом ДНК Ku70 / 80 независимо, хотя стабилизирующий эффект DNA-PK CS на лигазу IV / XRCC4 в комплексах NHEJ не будет неожиданным (32).Т.о., факторы NHEJ не нужно рекрутировать в фиксированном порядке, и стабильные комплексы NHEJ могут возникать в результате разных путей сборки.

Использование GFP-меченых белков обеспечивает средства для определения относительной силы взаимодействий между этими факторами на концах ДНК in vivo . Например, основные кинетические параметры можно оценить, используя накопление и FRAP в экспериментах по локальному повреждению in vivo (неопубликованные данные) и k на и к Значения off можно сравнить с результатами исследований связывания in vitro in vitro.Кроме того, точная оценка аффинности связывания in vivo и в различных генетических фонах позволит коррелировать сборку и стабильность комплекса NHEJ с эффективностью восстановления механизма NHEJ.

Материалы и методы

Плазмиды и клеточные линии.

КДНК

Ku80 амплифицировали с помощью ОТ-ПЦР из мРНК клеток HeLa с праймерами DG135 (5′-CGGGATCCATGGTGCGGTCGGGGAATAAGG) и DG136 (5′-TCTAGTCGACCTATATCATGTCCAATAAATCGTC).Этот продукт ПЦР расщепляли BamHI и SalI и лигировали с сайтами BglII и SalI pEGFP-C1 (Clontech, Mountain View, CA). Стабильные клоны XR-V15B, экспрессирующие EGFP-Ku80 (33), тестировали на экспрессию эндогенного (хомячок) Ku80 методом RT-PCR с использованием праймеров HTB31 (5′-GATTGTAGCCTATAAATCGATC) и HTB32 (5′-CAAAATGTGCTGCTGAATTGG). Другими клеточными линиями, использованными в этом исследовании, были XR-C1 с дефицитом ДНК-PK CS (34), XR-1 с дефицитом XRCC4 (35), клетки HeLa и человеческие фибробласты SC2 с дефицитом лигазы IV, экспрессирующие EGFP-лигазу IV ( 36).

Лизис клеток, иммунопреципитация и иммуноблоттинг.

Клетки обрабатывали ультразвуком в буфере для лизиса [20 мМ ацетата натрия, pH 7,4 / 350 мМ NaCl / 5 мМ MgCl 2 / смесь 5% глицерина и ингибитора протеазы (Roche, Базель, Швейцария)] и очищали центрифугированием. Белки разделяли с помощью SDS / PAGE, проводили электроблоттинг и детектировали с помощью первичных поликлональных козьих антител против Ku70 (M-19) или против Ku86 (M-20) (Santa Cruz Biotechnology, Санта-Крус, Калифорния) или кроличьих антител против GFP ab290. поликлональные антитела (Abcam, Cambridge, U.К.). Для иммунопреципитации 100 мкг общего белка разводили в 1 мл буфера для лизиса, предварительно очищенного 25 мкл гранул протеина A (Amersham, Piscataway, NJ), инкубировали с 1 мкг антитела против Ku70 Ab-4 (клон N3h20; Neomarkers, Фремонт, Калифорния) в течение 5 ч при 4 ° C, осаждали 50 мкл гранул протеина A (50% суспензия в буфере для лизиса) в течение 2 ч при 4 ° C, трижды промывали буфером для лизиса и анализировали с помощью вестерн-блоттинга.

Функциональные анализы.

Анализы соединения концов и рекомбинации V (D) J выполняли, как описано ранее (37).Для анализа выживаемости клетки высевали на чашки диаметром 6 см и оставляли для прикрепления в течение 12 часов перед получением однократной дозы γ-излучения от источника 137 Cs. Клетки выращивали в течение 5 дней и подсчитывали колонии.

Индукция повреждения ДНК в экспериментах по количественной визуализации живых клеток.

Индукция DSB в культивируемых клетках была получена путем воздействия 75 Гр γ-излучения (0,75 Гр / мин 137 источник Cs). Для лазерно-индуцированного повреждения ДНК лазер накачки Coherent Verdi с системой Ti: Sapphire с синхронизацией мод Mira 900 (Coherent, Санта-Клара, Калифорния) был напрямую подключен к микроскопу LSM 510 NLO (Carl Zeiss, Йена, Германия) для получения импульсный выход 800 нм (ширина импульса 200 фс при 76 МГц, выходная мощность 10 мВт на образце).Чтобы нацелить большое количество ядер, несколько соседних полей сканировались лазером NIR в виде равномерно расположенных параллельных линий. Для измерения отдельных ядер использовали воздействие 86 мс, ограниченное круговой областью 2,5 мкм, чтобы вызвать повреждение ДНК. Если указано, DRAQ5 (Biostatus, Шепшед, Великобритания) добавляли в концентрации 10 мкМ после индукции повреждения. Для визуализации живых клеток для обнаружения деления клеток через 2 часа после индукции повреждения добавляли 5 мМ кофеина, чтобы преодолеть контрольную точку G 2 / M.

Иммунофлуоресцентный анализ.

Клетки выращивали на покровных стеклах, дважды промывали PBS, содержащим 0,05% тритона X-100, и фиксировали смесью 2% параформальдегида / 0,025% тритона X-100 при 37 ° C. Покровные стекла промывали четыре раза PBS, содержащим 0,1% Triton X-100, и один раз PBS + (PBS, содержащим 0,15% глицина и 0,5% BSA). Клетки инкубировали при комнатной температуре с первичными антителами к фосфорилированному гистону h3AX (Upstate Biotechnology, Charlottesville, VA), Ku80 (C-20; Santa Cruz Biotechnology), DNA-PK CS , фосфорилированным на T2609 (38) или XRCC4 (NIh23). (39) в PBS + в течение 90 мин при комнатной температуре.После двух промывок PBS с 0,1% Triton X-100 и одной промывки PBS + покровные стекла инкубировали в течение 1 ч со вторичными антителами в PBS + . Избыток антител смывали двумя 10-минутными промывками PBS / 0,1% Triton X-100, и клетки помещали с помощью Vectashield, включая DAPI (Vector Laboratories, Burlingame, CA). Окрашивание TUNEL проводили, как описано производителем (набор для обнаружения смерти клеток In situ ; Roche).

Микроскопия и количественные измерения флуоресценции.

Imaging и FRAP эксперименты были выполнены на многофотонном конфокальном микроскопе LSM 510 NLO (Carl Zeiss, Jena, Germany). Полученные цифровые изображения были обработаны и проанализированы с помощью ImageJ (40). Визуализация иммунофлуоресцентных анализов включала последовательное использование лазеров с длиной волны 405, 488 и 561 нм для возбуждения красителей DAPI, EGFP и Alexa Fluor 594. Не было обнаружено явного «просачивания» между различными каналами обнаружения.

Кинетику накопления EGFP-Ku80 при лазерном повреждении ДНК получали путем измерения средней флуоресценции в целевой области.Флуоресценция до индукции повреждения была установлена ​​на 0, и данные были нормализованы до максимального уровня накопления EGFP-Ku80 (подробности см. В Supporting Text , который опубликован в качестве дополнительной информации на веб-сайте PNAS). FRAP на локальных повреждениях был выполнен после 10-минутного периода накопления. Фоновую флуоресценцию вычитали и данные нормализовали по предварительно обесцвеченной флуоресценции. По показаниям добавляли 20 мкМ вортманнина (Sigma, Сент-Луис, Миссури) за 45 минут до индукции повреждения.

Экспрессия, очистка и перекрестное связывание белков.

Ku70 / 80 был экспрессирован в клетках насекомых и очищен с использованием Ni 2+ Sepharose и колонок с двухцепочечной ДНК-целлюлозой, как описано (41). Комплексы XRCC4 и лигаза IV / XRCC4 были экспрессированы в Escherichia coli и очищены, как описано (39). Химическое сшивание проводили с использованием трехфункционального сшивающего агента сульфо-SBED (Pierce, Rockford, IL) в соответствии с инструкциями производителя.Вкратце, Ku70 / 80 диализовали против 20 мМ Hepes (pH 7,5), 100 мМ KCl, 1 мМ DTT и 10% (об. / Об.) Глицерина и инкубировали с 10-кратным молярным избытком сульфо-SBED в течение 2 часов при 4 ° С. Избыток сшивающего агента гасили 20 мМ Трис · HCl (pH 7,5), и белки хранили при -80 ° C до использования. Этот белковый препарат инкубировали с XRCC4 или белковыми экстрактами в течение 30 минут на льду с последующей активацией сшивающего агента светом 365 нм в течение 5 минут при комнатной температуре. Белки разделяли с помощью SDS / PAGE, окрашивали и анализировали масс-спектрометрией MALDI-TOF, как описано (42).

Благодарности

Мы благодарим доктора Дэвида Чена и сотрудников (Юго-западный медицинский центр Техасского университета, Даллас, Техас) за антисыворотку против фосфорилированной ДНК-PK CS и сообщение неопубликованных результатов. Мы также благодарны доктору Герту ван Каппеллену из Центра оптической визуализации (Erasmus MC) за помощь в конфокальной микроскопии и за полезные обсуждения с доктором Коосом Ясперсом и другими членами наших групп. Работа была поддержана Ассоциацией международных исследований рака (проекты 02-071 и 05-135), Голландским фондом рака (проект EUR 2002-2734), Нидерландской научной организацией (проект 901-01-184) и Европейской организацией. Союз (Проекты РИСЦ-РАД и ДНК Ремонт).

Сноски

  • Кому корреспонденцию следует направлять по адресу:
    Отделение клеточной биологии и генетики, Erasmus MC, Университетский медицинский центр, P.O. Box 2040, 3000 CA, Роттердам, Нидерланды.
    Эл. Почта: d.vangent {at} erasmusmc.nl
  • Вклад авторов: P.-O.M. и B.I.F. внес равный вклад в эту работу; П.-О.М., Б.И.Ф., А.Б.Х. и Д.C.v.G. спланированное исследование; P.-O.M., B.I.F., S.P.P., N.S.V., H.T.B., G.G.-M. и K.B. проведенное исследование; М.М. и T.M.L. внесены новые реагенты / аналитические инструменты; P.-O.M. и J.A.A.D. проанализированные данные; и П.-О.М. и D.C.v.G. написал газету.

  • Авторы заявляют об отсутствии конфликта интересов.

  • Сокращения:
    FRAP,
    восстановление флуоресценции после фотообесцвечивания;
    NHEJ,
    негомологичное соединение концов;
    DSB,
    двухцепочечный разрыв;
    ДНК-ПК,
    ДНК-зависимая протеинкиназа;
    ближний ИК-диапазон,
    ближний ИК-диапазон.
  • © 2006 Национальная академия наук США

Человеческое антитело Ku70 / XRCC6 AF5597: R&D Systems

Краткое описание человеческих антител Ku70 / XRCC6

Специфичность

Обнаруживает эндогенный Ku70 человека с помощью вестерн-блоттинга.

Источник

Поликлональный козий IgG

Очистка

Антиген Аффинно-очищенный

Иммуноген

E.coli -производный рекомбинантный человеческий Ku70
Asn405-Lys556
Номер доступа P12956

Состав

Лиофилизирован из отфильтрованного 0,2 мкм раствора в PBS с трегалозой. * Небольшая упаковка (SP) поставляется в виде отфильтрованного 0,2 мкм раствора в PBS.

Приложения

Рекомендуемая концентрация

Образец

Вестерн-блот

1 мкг / мл

См. Ниже

Обратите внимание: оптимальные разведения должны определяться каждой лабораторией для каждого применения.Общие протоколы доступны в разделе «Техническая информация» на нашем сайте.

Пример данных

Обнаружение Ku70 / XRCC6 человека с помощью вестерн-блоттинга. Вестерн-блоттинг показывает лизаты линии клеток лимфомы Беркитта человека Raji, линии клеток рака груди человека MCF-7 и линии клеток эмбриональной почки человека HEK293.PVDF-мембрану зондировали с помощью 1 мкг / мл очищенного сродством к антигену Ku70 / XRCC6 поликлонального антитела человека (каталожный № AF5597), а затем вторичного антитела против козьего IgG, конъюгированного с HRP (каталожный № HAF017). Специфическая полоса была обнаружена для Ku70 / XRCC6 при приблизительно 70 кДа (как указано). Этот эксперимент проводился в восстанавливающих условиях и с использованием буфера иммуноблоттинговой группы 1.

Калькулятор восстановления

Калькулятор восстановления

Подготовка и хранение

Восстановление

Восстановить на 0.2 мг / мл в стерильном PBS.

Доступен буфер восстановления

Доставка

Изделие транспортируется при температуре окружающей среды. После получения немедленно храните его при температуре, рекомендованной ниже. * Малый размер упаковки (SP) поставляется с полярными упаковками. После получения сразу же хранить при температуре от -20 до -70 ° C.

Стабильность и хранение

Используйте морозильную камеру для размораживания вручную и избегайте повторяющихся циклов замораживания-оттаивания.
  • 12 месяцев с даты получения, от -20 до -70 ° C в состоянии поставки.
  • 1 месяц, от 2 до 8 ° C в стерильных условиях после восстановления.
  • 6 месяцев, от -20 до -70 ° C в стерильных условиях после восстановления.

Фон: Ku70 / XRCC6

Ku70 (аутоантигенный белок 70 Lupus Ku; также АТФ-зависимая субъединица 1 ДНК-геликазы 2) представляет собой повсеместный ядерный белок 70-75 кДа, который служит компонентом ДНК-зависимого протеинкиназного комплекса ДНК-PK.В частности, он гетеродимеризуется с Ku80 с образованием комплекса, который связывает концы ДНК и выбирает последовательности, и который рекрутирует ДНК-PKcs с целью фосфорилирования нескольких белков, связанных с хроматином, включая p53, Oct-1 и Sp-1. Комплекс Ku: ДНК-PKcs участвует в репарации ДНК, репликации ДНК и рекомбинации VDJ. Длина Ku70 человека составляет 609 аминокислот (а.о.). Он содержит основной домен Ku (266‑529 аминокислот), ДНК-связывающий мотив (268‑274 аминокислот), NLS (539‑556 аминокислотных остатков) и C-концевой домен SAP (аминокислотные остатки 573‑607).Существует одна потенциальная форма сплайсинга, которая показывает делецию аа 66-106. Более чем 405-556 Ku70 имеет 83% идентичности с мышью Ku70.

Длинное имя

Белок аутоантигена Lupus Ku 70

Идентификаторы гена Entrez

2547 (человек)

Альтернативные имена

5′-дезоксирибозо-5-фосфатлиаза Ku70; 5′-dRP лиаза Ku70; Субъединица Ku антигена 70 кДа; АТФ-зависимая ДНК-геликаза 2 субъединица 1; АТФ-зависимая ДНК-геликаза II, субъединица 70 кДа; CTC-бокс-связывающий фактор субъединица 75 кДа; CTC-бокс-связывающий фактор субъединица 75 кДа; CTC75; CTCBF; D22S731; EC 3.6.4.-; EC 4.2.99.-; G22P1; G22P1Ku70; Субъединица р70 аутоантигена Ku; Ку-аутоантиген, 70 кДа; Ku70; ML8; Субъединица ML8,70 кДа; аутоантиген щитовидной железы р70; Аутоантиген щитовидной железы; TLAA; TLAAD22S671; Рентгеновская репарация, дополняющая дефектную репарацию в клетках китайского хомячка, белок репарации 6ДНК XRCC6; Перекрестно комплементарный белок 6, восстанавливающий рентгеновские лучи; XRCC6

SAP-домен формирует гибкую часть апертуры ДНК в Ku70 / 80 — Hnízda — 2021 — The FEBS Journal

Сокращения

  • CTD
  • С-концевой домен
  • DSA
  • Ди (N-сукцинимидил) адипат
  • NHEJ
  • негомологичное соединение концов
  • TF
  • фактор транскрипции
  • Введение

    двухцепочечных разрывов ДНК представляют собой наиболее опасный тип повреждений ДНК, которые, если их не исправить должным образом, могут нарушить геномную целостность клеток.Негомологичное соединение концов (NHEJ) является важным механизмом репарации, который облегчает повторное соединение разрывов ДНК на протяжении всего клеточного цикла.

    Этот процесс опосредуется комплексом Ku70 / 80, который распознает концы разорванной ДНК и служит центром взаимодействия для рекрутирования нижестоящих компонентов пути NHEJ [[1]]. Помимо NHEJ, Ku70 / 80 также играет важную роль во многих биологических процессах, включая поддержание теломер [[2]], репликацию ВИЧ [[3]] и подавление апоптоза [[4]].

    Ku70 и Ku80 образуют псевдосимметричный гетеродимер с предварительно сформированным кольцом (также называемым апертурой ДНК), ответственным за независимое от последовательности связывание ДНК. Две субъединицы имеют общую доменную топологию, включающую N-концевой α / ß домен, центральную область (ß-ствол и мостик, соединенные столбиками), за которым следует спиральное плечо (Fig. 1A) [[5]]. Ku70 содержит C-концевой домен (CTD), известный как домен SAP, состоящий из трех альфа-спиралей (5 кДа) [[6]], тогда как Ku80 содержит глобулярную область 19 кДа со сверхспиральной топологией [[7, 8]].CTD обеих субъединиц связаны с их соответствующими белковыми ядрами через гибкие линкеры, значительно увеличивая конформационную гибкость Ku70 / 80.

    Сравнение кристалла апоформы Ku70 / 80 (Ku70 / trKu80) и крио-ЭМ структур. (A) Кристаллическая структура Ku70 / 80 (PDB ID 1JEQ; показаны виды спереди и сбоку). (B) Кривая FSC поперечно сшитой апо-формы Ku70 / 80. (C) Крио-ЭМ анализ сшитого комплекса Ku-ДНК не выявил плотности для домена SAP.Показана карта плотности ЭМ (слева) с ее структурной моделью (в центре) и их наложение (справа). (D) Карта плотности ЭМ (слева) и уточненная структурная модель (справа) для апо-формы Ku70 / 80, сшитой с DSA. (E) Наложение карты плотности ЭМ для сшитой апо-формы Ku70 / 80 с ее структурной моделью (показаны виды спереди и сбоку). Дополнительная плотность окрашена в красный цвет. Положение домена SAP в кристаллической структуре выделено пурпурным рисунком. (F) Наложение карты EM для апо-формы Ku70 / 80 без перекрестных связей с ее структурной моделью.Окраска такая же, как для панели C. Структурные изображения были созданы с помощью химеракса.

    Хотя известно, что Ku80 CTD ответственен за рекрутирование ДНК-PKcs (ДНК-зависимая протеинкиназа, каталитическая субъединица) на сломанные концы [[9, 10]], биологическая функция домена Ku70 SAP все еще остается загадкой. Домен SAP состоит из трех альфа-спиралей с топологией, типичной для ДНК-связывающих белков [[5]]. Действительно, он связывается с ДНК, но с гораздо более низким сродством, чем отверстие ДНК Ku70 / 80 [[6]].Кристаллографическое исследование Ku70 / 80 показало, что домен SAP локализован рядом с доменом Ku80 α / ß, но дистальнее центральной апертуры ДНК. После связывания ДНК с Ku70 / 80 домен SAP больше не связывается в этом положении и, вероятно, колеблется между несколькими состояниями, что приводит к отсутствию плотности в кристаллической структуре связанного с ДНК состояния [[5]]. Эти структурные перестройки домена SAP при связывании ДНК наблюдались также с использованием крио-ЭМ низкого разрешения [[11]] и посредством ограниченного протеолиза и химического мечения поверхности белка [[12]].

    Интересно, что домен SAP оказался важным для взаимодействия Ku70 / 80 с несколькими факторами транскрипции (TF), содержащими гомеодомены, включая гомеобокс C4 (HOX C4) и октамерсвязывающий фактор транскрипции 1 (OCT-1) [[13]] . Межмолекулярное взаимодействие с ДНК-связывающими доменами от различных TF до Ku70 / 80 оказывает различное влияние на эффективность NHEJ. В то время как гомеобокс B7 (HOX B7) увеличивал эффективность NHEJ в эпителиальных клетках [[14]], гомеобокс 2 каудального типа (CDX2) и связанный с селекцией тимоцитов высокоподвижный белок группового бокса (TOX) ингибировали восстановление разорванных концов при раке толстой кишки [[14]]. [15]] и лейкоз [[16]].Однако структурные детерминанты взаимодействия Ku70 / 80 и TFs, опосредованные доменом SAP, в значительной степени не определены.

    Здесь наша цель — охарактеризовать взаимодействия домена SAP внутри гетеродимера Ku70 / 80. Комбинируя крио-ЭМ, масс-спектрометрический анализ межмолекулярного сшивания и молекулярное моделирование, мы фиксируем вариабельные положения домена SAP и его междоменные взаимодействия в Ku70 / 80. Мы также описываем структурные перестройки, вызванные связыванием ДНК.Эти идеи предоставляют полезную информацию о возможных биологических функциях домена SAP.

    Результаты

    Криоэлектронная микроскопия выявила дополнительную плотность на апертуре ДНК

    Чтобы зафиксировать положение домена SAP в гетеродимере Ku70 / 80, мы использовали межмолекулярное поперечное сшивание с последующей крио-ЭМ одиночной частицей. Мы проанализировали форму апо и связанное с ДНК состояние, обработанное ди (N-сукцинимидил) адипатом (DSA), амино-реактивным сшивающим агентом с длиной спейсерного плеча 8.6 Å [[17]]. В случае апо-формы полноразмерный Ku70 / 80 проявлял высокую склонность к образованию агрегатов на ЭМ-сетках, тогда как усеченный белок Ku70 / tr80 (комплекс Ku70 / 80, состоящий из полноразмерного Ku70 и усеченного Ku80, лишенного остатков 566– 732) привело к равномерному распределению частиц. Поэтому Ku70 / tr80 был использован для последующего анализа с использованием крио-ЭМ и масс-спектрометрии.

    Было собрано

    наборов данных Cryo-EM как для апо-формы, так и для ДНК-связанной формы Ku70 / tr80, чтобы предоставить достаточно частиц для трехмерной реконструкции (226 000 и 216 000 для апо-формы и связанной с ДНК, соответственно).В результате структура апо-формы была реконструирована до общего разрешения 3,2 Å, а связанная форма ДНК — до 3,8 Å (рис. 1B). Структурные модели уточняли по полученным ЭМ картам и сравнивали с их кристаллическими структурами. В случае Ku70 / 80, связанного с ДНК, рассчитанная плотность ЭМ хорошо соответствовала ранее описанной кристаллической структуре (PDB ID 1JEY), в которой плотность для домена SAP не наблюдалась (рис. 1C). Суперпозиция кристаллической и ЭМ структур выявила RMSD для 1021 C α атомов, равную ≈ 1.2 Å, демонстрируя лишь незначительные различия между двумя моделями Ku70 / 80, связанного с ДНК.

    Затем мы сравнили нашу карту плотности ЭМ для сшитой апо-формы Ku70 / 80 с доступной кристаллической структурой (PDB ID 1JEQ). Этот анализ выявил различные положения домена SAP в крио-ЭМ структуре по сравнению с таковым в кристаллической структуре (рис. 1A, D, E), хотя димерное ядро ​​комплекса не показало каких-либо значительных изменений (RMSD для 1017 C α атомов ≈ 0.8 Å). В кристаллической структуре домен SAP локализован в непосредственной близости от α-спиралей 5 и 6 (а.о. 145–157 и 200–214) из α / ß домена Ku80. Эти междоменные контакты опосредуются через первую область витка спирали домена SAP (а.о. 559–577), но наличие только нескольких прямых контактов (в частности, трех полярных взаимодействий и одного контакта Ван-дер-Ваальса) указывает на довольно слабое взаимодействие между ними. соответствующие регионы. Напротив, карта EM не содержала никакой плотности для области SAP в этом регионе.Интересно, что дополнительная плотность наблюдалась на границе димеризации вблизи апертуры ДНК (рис. 1E). Однако эта плотность была очевидна только на нижнем уровне контура и была довольно фрагментарной, что не позволяло уверенно подгонять модель. Положение этой дополнительной плотности оказалось близко к петле, которая соединяет спиральное плечо и домен SAP в Ku70 (а.о. 530–537). Более того, эта плотность соответствует общему размеру и форме области SAP. Эти наблюдения показывают, что домен SAP может быть локализован в апертуре ДНК.

    Чтобы оценить влияние перекрестного связывания на вероятное положение домена SAP на карте плотности EM, мы проанализировали немодифицированную форму апо Ku70 / tr80. Мы получили 94 000 частиц, что позволило нам рассчитать карту плотности ЭМ с разрешением 4,3 Å. В соответствии с результатами, полученными для сшитого комплекса, мы наблюдали такую ​​же дополнительную плотность в апертуре ДНК (рис. 1F), которая была плохо разрешена из-за высокой конформационной гибкости. Это показывает, что положение этой плотности не было вызвано сшивкой.

    Таким образом, крио-ЭМ анализ Ku70 / 80 показал, что домен SAP нестабильно связан с комплексом Ku70 / 80, но, вероятно, локализован в апертуре ДНК, из которой он вытесняется при связывании ДНК.

    Масс-спектрометрия зафиксировала колебания положения домена SAP

    Для дальнейшей проверки наблюдаемого положения домена SAP мы выполнили масс-спектрометрический анализ, чтобы локализовать ограничения расстояния в Ku70 / 80.Для этого мы применили сшивающий агент DSA, который использовался для нашего крио-ЭМ анализа. Чтобы оценить конформационные изменения при связывании ДНК, мы сравнили относительное количество поперечных сшивок в состояниях, связанных с апо и ДНК, с помощью количественного эксперимента с использованием изотопно меченых DSA ( 12 C / 13 C), как описано ранее [[18] ].

    Используя жидкостную хроматографию в сочетании с масс-спектрометрией с ионным циклотронным резонансом с преобразованием Фурье, мы идентифицировали 24 поперечные связи в Ku70 / tr80 (список поперечных связей см. В Таблице 1).Сравнение масс-спектрометрического анализа с доступными структурными моделями показало, что 14 связей были захвачены в ядре Ku70 / 80 (aa 35–537 в Ku70 и 5–542 в Ku80), семь связей были локализованы в домене SAP (aa 538–609), а три звена были локализованы в гибких петлях, отсутствующих в доступных структурных моделях (а.о. 1–34 в Ku70 и 543–565 в Ku80). Дальнейший анализ поперечных связей в ядре комплекса показал, что 12 из 14 (86%) связей связывают два остатка лизина, расположенные близко друг к другу в структурной модели Ku70 / 80.Это продемонстрировало, что межмолекулярное сшивание в сочетании с масс-спектрометрическим анализом Ku70 / 80 обеспечивает структурно релевантную информацию. Наиболее важно то, что в домене SAP было обнаружено семь перекрестных ссылок, предоставляющих информацию об этом регионе. В то время как четыре из этих перекрестных связей представляли соединения остатков в пределах домена SAP (внутридоменное перекрестное связывание), другие три перекрестных связей выявляли контакты домена SAP с различными частями комплекса Ku70 / 80 (междоменное перекрестное связывание).В частности, мы идентифицировали пространственные ограничения домена SAP со спиральным плечом Ku70 (aa 450-538) и с центральным доменом Ku80 (aa 242-433), формирующим апертуру ДНК (Fig. 2).

    Таблица 1. Список сшивок в Ku70 / 80, идентифицированных масс-спектрометрией.
    Сшивка Локализация в комплексе Ку70 / 80
    N конец (Ku70) — Lys 260 (Ku70) N-концевой шлейф с ß-цилиндром
    N конец (Ku70) — Lys 543 (Ku80) Гибкие клеммные шлейфы
    N конец (Ku70) — Lys 544 (Ku80) Гибкие клеммные шлейфы
    Lys 9 (Ku70) — Lys 253 (Ku70) N-концевая петля с линкером между ß-стволом и α / ß доменом
    Lys 31 (Ku70) — Lys 253 (Ku70) N-концевая петля с линкером между ß-стволом и α / ß доменом
    Lys 31 (Ku70) — Lys 297 (Ku70) N-концевой шлейф с перемычкой
    Lys 189 (Ku70) — Lys 445 (Ku70) α / ß домен с линкером между ß-стволом и спиральным плечом
    Lys 189 (Ku70) — Lys 565 (Ku80) α / ß домен с С-концевой петлей (Ku80)
    Lys 260 (Ku70) — Lys 543 (Ku80) ß-ствол (Ku70) со стойкой (Ku80)
    Lys 282/7 (Lys70) — Lys307 (Ku80) Опорная зона (Ку70) с перемычкой (Ку80)
    Lys 317 (Ku70) — Lys 282 (Ku80) Мостовой район
    K463 (Ku70) -Lys565 / 570 (Ku70) Винтовая рука с доменом SAP
    Lys 468 (Lys70) — Lys 510 (Ku70) Винтовая штанга
    Lys468 (Ku70) — Lys516 (Ku70) Винтовая штанга
    Lys539 (Ku70) — Lys542 (Ku70) Линкер между спиральным плечом и доменом SAP
    Lys539 (Ku70) -Lys544 (Ku70) Линкер между спиральным плечом и доменом SAP
    Lys539 (Ku70) — K399 (Ku80) ß-ствол (Ku80) с линкером между спиральным плечом и доменом SAP
    Lys565 / 570 (Ku70) — K334 (Ku80) Pillar region (Ku80) с доменом SAP
    Lys575 (Ku70) -Lys596 (Ku70) домен SAP
    Lys596 (Ku70) — Lys605 (Ku70) домен SAP
    Lys51 (Ku80) — Lys 273 (Ku80) Столбиковая область с доменом α / ß
    Lys273 (Lys80) — Lys399 (Ku80) Область столба с ß-стволом
    Lys 291 (Ku80) — Lys 413 (Ku80) Мост с ß-стволом
    Lys 532 (Ku80) — Lys 565 (Ku80) Гибкая клеммная колодка
    Междоменные сшивки остатков лизина в домене SAP.(A) Перекрестная связь между Lys334 (Ku80) и Lys556 / 565 (домен SAP в Ku70). (B) Перекрестная связь между Lys399 (Ku80) и Lys539 (домен SAP в Ku70). (C) Сшивка между Lys463 (спиральное плечо в Ku70) и Lys565 / 570 (домен SAP в Ku70). На каждой панели показаны масс-спектры для отдельной перекрестной связи вместе со структурной моделью Ku70 / 80, включая домен SAP и его гибкий линкер. Слева показаны масс-спектры для идентификации перекрестных связей и количественного сравнения апоформы с состоянием, связанным с ДНК.Масс-спектры для идентификации (верхняя часть) содержали пару пиков, являющихся результатом меченного изотопом сшивающего агента DSA (C12 / C13). Количественное сшивание (нижняя часть) показывает относительные различия между формой апо и связанным с ДНК состоянием. Справа Структурная модель ядра для апо-формы Ku70 / 80 основана на наших ЭМ-данных и показана в виде поверхности. Различные положения домена SAP (модель ЯМР PDB ID 1JJR), включая гибкий линкер, показаны только для ясной иллюстрации сшитых остатков, которые выделены красными сферами.Структурные изображения были получены с помощью пимола.

    Перекрестное связывание между доменом SAP и центральным доменом Ku80 наблюдалось в двух регионах. Первый соединил Lys 556/565 из первой спирали домена SAP с Lys 334, локализованным в петле, соединяющей ß-ствол с мостовой областью Ku80 (фиг. 2A; поперечная связь № 1). Это перекрестное связывание было обнаружено только в апо-форме, поскольку связывание ДНК полностью предотвращало реакцию связывания. Это наблюдение дополнительно подтверждает, что контакт между доменом SAP и апертурой ДНК нарушается связыванием ДНК.Вторая поперечная сшивка связала Lys 539 (Ku70) с Lys 399 (Ku80). Остаток Lys 539 локализован в гибкой петле Ku70 (а.о. 535–558), соединяющей спиральное плечо с доменом SAP. В Ku80 Lys399 лежит в петле между двумя ß-цепями ß-бочкообразного домена, который формирует часть апертуры ДНК (Fig. 2B). Связь соответствующих участков наблюдалась преимущественно в апо-форме, а не в связанном с ДНК состоянии. Это наблюдение показало временный контакт линкера, соединяющего ядро ​​Ku70 / 80 с доменом SAP, и его смещение из-за структурных перестроек при связывании ДНК.

    Сшивание Lys 463 спирального плеча с Lys 565/570 из домена SAP в Ku70 продемонстрировало пространственную близость первой спирали домена SAP (aa 559–577) с α-спиралью 14 (aa 455– 469) спирального плеча, локализованного под апертурой ДНК (рис. 2С; сшивка № 3). Это перекрестное сшивание наблюдали как в апо-форме, так и в состоянии, связанном с ДНК, и относительная количественная оценка показала лишь незначительные изменения, вызванные связыванием ДНК. Это наблюдение согласуется с доступными структурами, в которых контакт между этими областями совместим со связыванием ДНК с Ku70 / 80.

    В целом, наш масс-спектрометрический анализ подтвердил локализацию домена SAP в апертуре ДНК комплекса Ku70 / 80, как показано на картах плотности EM. Кроме того, масс-спектрометрические данные предоставили дополнительную информацию о флуктуирующих положениях домена SAP и описали структурные изменения, вызванные связыванием ДНК. Выявленное сшивание также показало альтернативное положение домена SAP по сравнению как с нашими данными крио-ЭМ, так и с предыдущими кристаллическими структурами.

    Структурное моделирование определило возможные позиции домена SAP

    Чтобы объединить результаты крио-ЭМ и масс-спектрометрии, мы выполнили расчеты структурного моделирования. В частности, мы использовали метод слепой стыковки с последующей оценкой ограничений, полученных на основе полученных перекрестных ссылок. Были получены три докинговых раствора, которые фиксировали конформации как апо, так и ДНК.

    Первая модель апо-формы Ku70 / 80 соответствовала нашим крио-ЭМ картам, так что две из трех перекрестных связей [перекрестные связи №1 — Lys 334 (Ku80) — Lys 556/565 (Ku70) и # 2 — Lys 399 (Ku80) — Lys 539 (Ku70)] были удовлетворены (рис.3А, Б). Возникновение обеих этих перекрестных связей между доменом SAP и центральным доменом Ku80 резко снизилось в ДНК-связанной форме Ku70 / 80, подтверждая предположение, что этот способ взаимодействия требует формы апо и нарушается связыванием ДНК. (Рис. 3B). Эта модель выявила расстояния C α -C α между Lys 334 (Ku80) и Lys 556 или Lys 565 (Ku70), равные 10 и 20 Å, соответственно, в то время как расстояние C α -C α между Lys 399 (Ku80) и Lys 539 (Ku70) составляет 19 Å.

    Структурное моделирование, управляемое крио-ЭМ и масс-спектрометрией, показывает различные положения домена SAP. Части Ku70 / 80 окрашены следующим образом: субъединица Ku70 (а.о. 1–537) — синий; домен SAP (а.о. 538–609 в Ku70), пурпурный; Субъединица Ku80, зеленый цвет; Молекула ДНК, оранжевый. (A) Апо-форма Ku70 / 80 с доменом SAP, локализованным в апертуре ДНК, как показано на структурной модели, наложенной на нашу крио-ЭМ карту. Структурные изображения были созданы с помощью химеры ucsf.(B) Апо-форма Ku70 / 80 с доменом SAP в апертуре ДНК, что демонстрируется перекрестными связями №1 и №2 в апо-форме (слева). Это положение домена SAP несовместимо со связыванием ДНК, как показано наложением апоформы на состояние, связанное с ДНК (справа). Структурные изображения были получены с помощью пимола (слева) и химеракса (справа). (C) Апо-форма Ku70 / 80 (верхняя часть) и комплекс Ku-ДНК (нижняя часть) с доменом SAP, локализованным под апертурой ДНК в двух возможных положениях, как показано на конформерах 1 и 2.Эти модели поддерживаются наличием сшивки №3. Структурные изображения были получены с помощью пимола.

    Два других полученных раствора для стыковки согласуются с экспериментальными данными как для апо, так и для ДНК-связанных комплексов, причем взаимодействия, опосредованные перекрестной связью № 3, наблюдаются в обоих образцах (рис. 3С). В обоих решениях домен SAP был расположен дистальнее апертуры ДНК. Расстояния C α -C α между Lys 334 (Ku80) и Lys 556 (Ku70) варьируются от 24 до 65 Å, в то время как расстояния C α -C α между Lys 334 (Ku80) и Lys 565 (Ku70) находится в диапазоне от 39 до 50 Å.Домены SAP в этих моделях расположены ближе к спиральному плечу под апертурой ДНК. В частности, расстояния C α -C α между Lys 463 (Ku70) и Lys 565 (Ku70) варьируются от 14 до 18 Å, а расстояния C α -C α между Lys 463 (Ku70) и Lys 570 (Ku70) находятся в диапазоне от 12 до 16 Å.

    Таким образом, структурное моделирование согласуется с экспериментальными наблюдениями с доменом SAP, существующим во множестве возможных конформаций как в апо, так и в связанных с ДНК формах.

    Обсуждение

    Домен SAP представляет собой структурный мотив длиной 35 остатков, который обнаруживается в ядерных белках, участвующих в транскрипции, репарации ДНК или процессинге РНК [[19]]. Он непосредственно участвует во многих биологических процессах, таких как апоптотическая конденсация хроматина [[20]], реакция на повреждение ДНК [[21]] или регуляция сплайсинга [[22]]. Обычно домен SAP одновременно взаимодействует с множеством партнеров по связыванию и действует как связующее звено в многокомпонентных сборках [[23, 24]].Домен SAP также расположен в C-концевой части Ku70, ключевого компонента пути NHEJ, но его структурное расположение и лежащая в основе биологическая функция все еще недостаточно изучены.

    Используя межмолекулярное сшивание в сочетании с крио-ЭМ и масс-спектрометрией, мы зафиксировали колеблющееся положение домена SAP в Ku70 / 80. Демонстрируя свою высокую позиционную гибкость, домен SAP был обнаружен в трех позициях. В первом положении домен SAP локализован в апертуре ДНК.Это положение наблюдалось только в апо-форме, поскольку связывание ДНК вызывало смещение домена SAP. Вторая и третья позиции находились ниже апертуры ДНК, рядом со спиральным плечом Ku70 (а.о. 450–538), что полностью совместимо со структурой комплекса Ku-ДНК. Все эти области отличаются от положения домена SAP, описанного в более ранней кристаллической структуре [[5]]. Различия могут быть объяснены изменениями, вызванными упаковкой кристаллов или различными экспериментальными условиями для каждого метода, которые позволили захватить только подмножество положений для домена SAP в комплексе Ku70 / 80.Примечательно, что домен SAP участвует во множественных контактах кристаллов в апо форме Ku70 / 80 (PDB ID 1JEQ; Fig. 4A). Комбинируя наше настоящее исследование и ранее описанную кристаллическую структуру [[5]], мы определяем область для движений домена SAP в апо форме и связанных с ДНК состояниях Ku70 / 80 (Fig. 4B).

    Междоменное взаимодействие в домене SAP. (A) Кристаллическая упаковка в апо-форме Ku70 / 80 (PDB ID 1JEQ). Домен SAP участвует во множественных контактах кристаллов. Одна единица Ku70 / 80 (красный цвет) показана с доменом SAP (пурпурный), который упакован по сравнению с окружающими единицами Ku70 / 80 (зеленый).(B) Возможные области взаимодействия для домена SAP в Ku70 / 80, выявленные с помощью нашего интегративного моделирования (интерфейсы 1-3 и 5-6 в апо и ДНК-связанной форме, соответственно) и предыдущей кристаллической структурой (интерфейс 4; PDB ID 1JEQ ). Интерфейсы выделены точками разных оттенков красного цвета. (C) Подробное взаимодействие домена SAP. Потенциальные позиции области SAP были определены с помощью интегративного моделирования под руководством крио-ЭМ карты и масс-спектрометрии. Апоформа Ku70 / 80 (верхняя часть) и комплекс Ku-ДНК (нижняя часть) с доменом SAP, локализованным либо в отверстии ДНК, либо под отверстием ДНК в двух возможных положениях, как показано на конформерах 1 и 2.Каждая часть Ku70 / 80 окрашена следующим образом: субъединица Ku70 (а.о. 1–537) — синий; домен SAP (а.о. 538–609), пурпурный; Субъединица Ku80, зеленый цвет; Молекула ДНК, оранжевый. Водородная связь и ионные взаимодействия выделены красными пунктирными линиями. Структурные изображения были получены с помощью пимола.

    Структура ЯМР домена SAP [[6]] выявила консервативный положительный участок на поверхности, образованный Lys582, Arg586, Lys591, Lys595 и Lys596. Основываясь на изменениях химического сдвига, Zhang et al .предположили, что остатки этого положительного участка могут непосредственно участвовать в связывании ДНК. В частности, Lys582 и Arg586 могут взаимодействовать с большой бороздкой ДНК, тогда как Lys591, Lys595 и Lys596 могут взаимодействовать с фосфатными группами остова ДНК. Однако в наших моделях связанного с ДНК Ku70 / 80 ни один из этих остатков не взаимодействует с ДНК, поскольку они разделены не менее чем на 25 Å. Можно предположить, что домен SAP может образовывать временные взаимодействия с ДНК, которая специфически формируется во время начального распознавания разрывов ДНК до того, как будет вытеснена из апертуры ДНК.

    Что касается остатков положительно заряженного участка на домене SAP, мы наблюдали их участие только в изолированных междоменных взаимодействиях внутри Ku70 / 80 в наших моделях (Fig. 4C). Это дополнительно подтверждает представление о временном характере взаимодействий между ядром Ku70 / 80 и доменом SAP.

    Чтобы сделать снимки гибких устройств в комплексе Ku70 / 80, мы использовали химическое сшивание с последующей структурной характеристикой.Действительно, перекрестное сшивание ранее применялось для изучения множества динамических сборок белок-ДНК, таких как комплекс MutH-MutL при репарации ошибочного спаривания ДНК [[25]], моноубиквитинлигаза в пути анемии Фанкони [[26]] или белок– нуклеосомные комплексы [[27]].

    Наше исследование — первое сообщение о локализации домена SAP в апертуре ДНК Ku70 / 80. Сравнение с описанными структурами для Ku-APLF и Ku-XLF [[28]] и DNA-PK [[29, 30]] показало, что другие партнеры связывания из пути NHEJ не мешают определенному положению для домена SAP (рис. .5). Наши результаты предполагают, что домен SAP может быть частью входных ворот для начального распознавания разрывов ДНК [[31]]. Интересно, что домен SAP связывается как с ДНК [[6]], так и с TF из семейства гомеобоксов [[13]], что указывает на его роль в транскрипции. Более того, несколько исследований продемонстрировали, что NHEJ в основном действует на транскрибируемые гены и что взаимодействие компонентов NHEJ с аппаратом транскрипции необходимо для эффективной репарации ДНК [32, 33]]. Таким образом, домен SAP может представлять собой важный структурный мотив, связывающий NHEJ и транскрипцию.Например, он может распознавать разрывы ДНК в транскрипционно активных генах посредством взаимодействия с ТФ, которые впоследствии удаляются из ДНК, что обеспечивает эффективную репарацию посредством NHEJ. Примечательно, что домен SAP в SAF-B может связывать белки пути процессинга пре-мРНК с транскрипционно активным хроматином [[24]]. В заключение, эта работа раскрывает структурную динамику домена SAP в Ku70 и предоставляет важную информацию для выяснения его роли в NHEJ и других биологических процессах.

    Четкое положение домена SAP и партнеров по связыванию Ku в наших структурных моделях и доступных экспериментальных структурах. Иллюстрация апо-формы Ku70 / 80 и комплексов Ku-ДНК показывает положения домена SAP (выделено пурпурным рисунком) в комплексе Ku70 / 80. Экспериментальные структуры для Ku-APLF (PDB ID 6ERF), Ku-XLF (PDB ID 6ERH) и ДНК-PK (PDB ID 6ZHA) показывают сайты связывания для взаимодействующих белков. Структурные изображения были созданы с помощью химеракса.

    Материалы и методы

    Белковый препарат

    Гетеродимер

    Ku70 / 80 был экспрессирован в клетках Sf9 и очищен, как описано ранее [[34]]. Вкратце, белки очищали с использованием аффинной хроматографии с иммобилизованным металлом с последующей ионообменной хроматографией (колонка Mono-Q; GE Healthcare, Chalfont St. Giles, Великобритания) и гель-фильтрацией (Superdex 200; GE Healthcare) в соответствии с опубликованными процедурами [[34]] . Правильную функцию очищенных белков проверяли с помощью анализа электрофоретической подвижности с меченным 6-FAM олигонуклеотидом длиной 20 п.о. (CTGATGCGTCGTCGGACTGA).В этом исследовании были использованы как полноразмерный белок, так и усеченный вариант, лишенный Ku80 CTD (Δ 566-732 как в [[5]], где гетеродимер известен как Ku70 / tr80). Для структурных исследований мы использовали Y-образный олигонуклеотид, состоящий из следующих цепей: CGCGCCCAGCTTTCCCAGCTAATAAACTAAAAACTATTA и TAATAGTTTTTAGTTTATTGGGCGCG. Олигонуклеотид смешивали с Ku70 / 80 в эквимолярном соотношении и предварительно инкубировали при комнатной температуре в течение 10 мин.

    Криоэлектронная микроскопия

    Пробоподготовка

    Ku70 / 80 белков (0.4 мг · мл -1 ) в 20 мМ фосфате натрия (pH 7,0), содержащем 50 мМ хлорида калия и 1 мМ DTT (буфер для сшивания), подвергали межмолекулярному сшиванию с использованием DSA (Creative Molecules Inc.) с белком. -сшивающие молярные отношения 1–20 и 1–50. После реакции сшивания (при комнатной температуре в течение 1 ч) белки фракционировали с использованием гель-фильтрации (Superose 6 / 3.2; GE Healthcare). Гель-фильтрацию также использовали для фракционирования немодифицированных белков. Собирали фракции, содержащие Ku70 / 80, растворяли в сшивающем буфере, содержащем 0.05% октилглюкопиранозид (Avanti Polar Lipids, Алебастр, Алабастр, США), нанесенный на дырчатые углеродные решетки Quantifoil (Cu R1.2 / 1.3, 300 меш) (Agar Scientific, Станстед, Великобритания) и застеклованный в жидком этане.

    Сбор данных
    Наборы данных

    Крио-ЭМ были собраны в Департаменте биохимии Кембриджского университета (Ku70 / 80, связанный с ДНК и несшитая апо-форма Ku70 / 80) или в Центре электронной био-визуализации, Diamond Light Source (сшитый Ku70 / 80 форма апо).Данные крио-ЭМ собирали на электронном микроскопе Titan Krios (Thermo Fisher Scientific, Эйндховен, Нидерланды), работающем при 300 кВ с использованием детектора K2 или K3 (Gatan Inc., Плезантон, Калифорния, США) в режиме счета. Данные были записаны в условиях ~ 49,5 и 39,3 е- / Å 2 для 40 рамок (Ku-ДНК и сшитая апоформа) или 53,5 е- / Å 2 для 48 кадров (несшитая апоформа ) и диапазон расфокусировки от -1,2 до -2,7 мкм (от -0,9 до -2,7 мкм для комплекса Ku-ДНК). Настройка увеличения привела к размеру пикселя 1.07 Å (Ku-ДНК), 1,048 Å (перекрестно-сшитая форма апо) и 0,325 Å (несшитая форма апо).

    Обработка данных

    Для комплекса Ku-ДНК и сшитой формы апо MotionCor2 [[35]] и Gctf [[36]] использовались для коррекции движения и оценки CTF. Частицы сшитой апо-формы Ku70 / tr80 собирали с использованием CrYolo [[37]]. Данные обрабатывались в Relion 3.1 с использованием стандартных процедур [[38]]. В случае несшитой формы апо, коррекция движения, оценка CTF и выбор частиц выполнялись с использованием Warp [[39]], а обработка выполнялась с использованием CryoSparc [[40]].

    После первоначальной двухмерной классификации частицы были отсортированы с помощью трехмерной классификации. Обычно 25–50% частиц включались в 3-D класс с более высоким разрешением для гетеродимера Ku70 / 80. Другие 3-D классы содержали диссоциированный димер или белковый комплекс с плохим разрешением. Частицы выбранного трехмерного класса были дополнительно отфильтрованы и очищены. Общее разрешение окончательных карт было рассчитано с помощью корреляции Фурье-оболочки при отсечении 0,143 (рис.1Б).

    Доработка модели

    Доступные структурные модели (PDB ID 1JEY для комплекса Ku-ДНК и PDB ID 1JEQ для Ku-апо-формы) были состыкованы в результирующие карты с помощью phenix (версия 1.16-3546, Phenix, Berkeley, CA, USA). Структурные модели были перестроены в соответствии с картой EM в coot (версия 0.892, Coot, MRC MLB, Кембридж, Великобритания) и впоследствии уточнены с использованием уточнения в реальном пространстве в phenix. Полученные модели были визуализированы в pymol Viewer 1.5 (Schrodinger Inc., Нью-Йорк, Нью-Йорк, США), химера ucsf (версия 1.13.1, UCSF Chimera, Сан-Франциско, Калифорния, США) и химеракс (версия 1.1, ChimeraX, Сан-Франциско, Калифорния, США) [[41 ]]. Подробная информация о сборе данных Cryo-EM, уточнении и проверке модели приведена в таблице 2.

    Таблица 2. Сбор, уточнение и проверка статистики крио-ЭМ данных.
    Ku70 / 80 апо (EMDB ID_12

    939) (PDB 7AXZ)

    Сбор и обработка данных
    Увеличение 130 000
    Напряжение (кВ) 300
    Электронная экспозиция (e– / Å 2 ) 39.3
    Диапазон расфокусировки (мкм) от -1,20 до -2,7
    Размер пикселя (Å) 1,048
    Навязанная симметрия /
    Исходные изображения частиц (№) 568 771
    Окончательные изображения частиц (номер) 226 000
    Разрешение карты (Å) 3,2
    Порог FSC 0.143
    Уточнение
    Используемая исходная модель (код PDB) 1JEQ
    Повышение резкости карты B Фактор (Å 2 ) −40
    Состав модели
    Неводородные атомы 16 566
    Белковые остатки 1023
    B фактора (Å 2 )
    Белок (мин. / Макс. / Среднее) 36.53 / 152,56 / 89,30
    RMSD
    Длина связи (Å) 0,009
    Углы крепления (°) 0,873
    Проверка
    Оценка MolProbity 2.13
    Счет противоборства 11,35
    Плохие ротамеры (%) 0,00
    Участок Рамачандрана
    В избранном (%) 89.81
    Разрешено (%) 10,19
    Запрещено (%) 0,00

    Сшивание белков и масс-спектрометрия

    белков (0.4 мг · мл -1 ) в 20 мм фосфате натрия (pH 7,0), содержащем 50 мм хлорида калия и 1 мм DTT, обрабатывали эквимолярной смесью DSA 12 C 6 и DSA 13 C 6 сшивающих агентов в соотношении белок-сшивающий агент 1–20 и 1–50 в течение 1 ч при комнатной температуре. Белки расщепляли в растворе с использованием трипсина (Promega Corporation, Мэдисон, Висконсин, США) в течение 8 часов при 37 ° C и подвергали анализу с использованием жидкостной хроматографии в сочетании с масс-спектрометрией ионного циклотронного резонанса с преобразованием Фурье (LC-FT ICR MS), как описано ранее [[42]].

    Структурное моделирование

    Взаимодействия домена SAP с Ku70 были смоделированы с использованием Schrodinger (2018-4). Структуру домена SAP (а.о. 559–609) моделировали с использованием экспериментальной структуры ЯМР (PDB ID: 1JJR, [[6]]). Мы применили метод слепой стыковки, при этом лучшие решения оценивались по их способности удовлетворять экспериментальным ограничениям сшивки. Для поз, где домен SAP был расположен около плотности пустых электронов на границе димеризации, мы применили ограничение от 6 до 18 Å на расстояние между S244 и T577 Ku70.Для моделей, в которых домен SAP не находился в пределах этой электронной плотности, были применены два ограничения от 10 до 14 Å на расстояния между K463 и K565 / K570 Ku70. Гибкая петля от остатка G538 до E558 была впоследствии добавлена ​​к трем позам, удовлетворяющим этим ограничениям, с использованием Modeller версии 9.24 [[43]]. Цикл был построен с помощью команды automdel и уточнен в медленном режиме.

    Благодарности

    AH, DBA и AKC были поддержаны премией Wellcome Trust Investigator Award для TLB (200814 / Z / 16 / Z; 2016 -).DBA и TBN финансировались Фондом Джека Брокхоффа (JBF 4186, 2016), грантом для исследователей от Национального здравоохранения, Советом медицинских исследований (NHMRC) Австралии (GNT1174405) и частично Программой поддержки операционной инфраструктуры правительства штата Виктория. Наборы данных для криоэлектронной микроскопии были собраны в крио-электронных установках Департамента биохимии Кембриджского университета и Diamond Light Source Центра электронной био-визуализации, предложение EM17057-43, финансируемое Wellcome Trust, MRC и BBSRC.Мы благодарим Диму Чиргадзе, Стивена Хардвика, Адриану Клизейко и Ли Купера за любезную помощь в проведении крио-ЭМ измерений. Масс-спектрометрические измерения финансировались Европейской комиссией h3020 (проект EU_FT-ICR_MS — идентификатор грантового соглашения: 731077) и Центром ядерной структуры молекулярной структуры в BIOCEV (LM2018127 CIISB для CMS BIOCEV, финансируемый MEYS CR).

    Источники финансирования не участвовали ни на одном этапе нашего исследования.

      Конфликт интересов

      Авторы заявляют об отсутствии конфликта интересов.

      Вклад авторов

      AH задумал исследование, провел эксперименты и написал рукопись; PT, LK, RB и AC проанализировали данные ЭМ; ZK и PN проанализировали данные МС; TBN и DBA выполнили структурное моделирование; TLB задумал исследование. Все авторы отредактировали рукопись.

      Список литературы